Spergularia purpurea

(Pers.) G.Don · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Spergularia

At a glance

Occurrence records3 071

Data sources8

Biological traits20

DNA specimens3

eDNA detections1

Sources8 archives

Databases and archives Spergularia purpurea's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility3 071 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF3 071 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Spergularia purpurea, the purple sandspurry, is a species of annual herb in the family Caryophyllaceae (carpetweeds). They have a self-supporting growth form and simple, broad leaves. Individuals can grow to 9 cm.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology7

Plant height0.053 m

Seed mass0.02 mg

Seed mass max0.02 mg

Seed mass min0.02 mg

Seed volume0.015 mm³

Seed volume max0.015 mm³

Seed volume min0.015 mm³

Life cycle & reproduction3

Life formannual or biennial

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Growth formherb

Woodinessnon-woody

Physiology & chemistry2

Photosynthetic pathwayC3

Specific leaf area (SLA)17.34 mm²/mg

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spergularia purpurea has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences2

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPX286054.1 ↗228 bpSpain · 1984

ACGT

TCGTGCATGGGCGCGCCGGTCTTTTGGTCGGCAACCCCAGCCTTGGTGCGCCCGCTCTGGGAACGGGGCTGGCGTTCCCTCGGCAAGAAA …

Spergularia purpurea isolate CAR861 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★trnL-F★ITS2★ITS2cp-trnL-intron

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Spergularia purpurea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome records18–362n range36median36mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 365×CCDB · iber-fl · CCDB · fl-europaea · CCDB · book-ipcn67-71 +1

CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. III. Caryophyllaceae Fernandes, A. & M. T. Leitao.Bol. Soc. Brot. ser. 245: 143-176(1971).

CCDB · iber-fl — Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Luque, T. & Z. Daz Lifante.Bocconea1: 303-364(1991).

CCDB · fl-europaea — Ratter, 1964

CCDB · book-ipcn67-71 — FERNANDES, A., & M.T. LEITAO. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal III. Cariophyllaceae. Bol. soc. Brot. 45 (ser. 2): 143-176.

CCDB · CromoCat 2015 — Fernandes, A. & Leitão, M. T. (1971). Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. III. Caryophyllaceae. Bol. Soc. Brot. 45: 143-176.

2n 181×CCDB · fl-europaea

CCDB · fl-europaea — Blackburn &

n 183×CCDB · iber-fl · CCDB · CromoCat 2015

CCDB · iber-fl — Cytogenetic studies in Spergularia, I. Cytology of some old world species. Ratter, J. A.Notes Roy. Bot. Gard. Edinburgh25(3): 293-302(1964).

CCDB · CromoCat 2015 — Ratter, J. A. (1964). Cytogenetic studies in Spergularia, I. Cytology of some old world species. Notes Roy. Bot. Gard. Edinburgh 25(3): 293-302.

n 271×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Ratter, J. A. (1964). Cytogenetic studies in Spergularia, I. Cytology of some old world species. Notes Roy. Bot. Gard. Edinburgh 25(3): 293-302.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 071 records

Wild obs. + sensor2 728

Museum / vouchered342

Other1

Origin

Native62

Range

Area of Occupancy AOO7 460 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 903≤1 km 299≤10 km 901>10 km 8

2 111 georeferenced · 617 without coordinates

Open the mapobservation + sensor2 728

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 16≤1 km 84≤10 km 24>10 km 8

132 georeferenced · 210 without coordinates

Open the institutions mapphysical evidence342

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ISAlocation not on record	82
MAlocation not on record	61
Madrid, ES	26
College of the Atlantic, Museumlocation not on record	19
BClocation not on record	18
Badajoz, ES	17
Salamanca, ES	14
Entomological Society of Latvialocation not on record	13
València, ES	12
Granada, ES	11
Helsinki, FI	10
Barcelona, ES	7
Wlocation not on record	7
Jaén, ES	7
Phyletisches Museum Jenalocation not on record	7
BDBClocation not on record	5
LDlocation not on record	4
Alicante, ES	4
CICYTEXlocation not on record	3
Vitoria, ES	3
Sevilla, ES	2
Museo Achille Folettolocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Saint Louis, US	1
RABATlocation not on record	1
Paris, FR	1
Bronx, US	1
Kew, GB	1
Moscow State Universitylocation not on record	1
CIBIOlocation not on record	1

30 institutions · 341 of 342 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Spergularia purpurea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 15.4–15.4

Seasonal swing summer↔winter16.9 °C

Max temp (day)20.4 °C

Min temp (night)9.10 °C

Precipitation66.7 mm/mo

Air humidity56.0 %

Moisture balance-69.0 mm/mo

Vapour deficit774 Pa

Wind speed2.80 m/s

Cloud cover37.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Spergularia purpurea

At a glance

Sources8 archives

Size & morphology7

Life cycle & reproduction3

Diet & foraging1

Habitat & environment7

Physiology & chemistry2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 071 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 071 records