Spergularia media
(L.) C.Presl · speciesAt a glance
Occurrence records37 519
Data sources10
Biological traits76
DNA specimens22
eDNA detections10
Sources10 archives
Databases and archives Spergularia media's data was compiled from.
GBIFGlobal Biodiversity Information Facility37 519 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics22 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements5 literature sources76 traits
Occurrence & distributionGBIF37 519 records
Environmental DNA1 datasets · 3 countries10 detections
DNA & barcodingBOLD · NCBI22 specimens
Genome at a glanceCCDB · GoaT323 Mbp
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology25
Fruit length8 mm
Fruit length max9 mm
Fruit length min6 mm
Leaf length17.5 mm
⚠ sources differ — AusTraits: 17.5 mm · GIFT: 15 mm
Leaf length max35 mm
Leaf length min10 mm
Leaf mass0.795 mg
Leaf size32 mm²
⚠ sources differ — TRY: 32 mm² · LEDA: 20.88 mm² · GIFT: 20.88 mm²
Leaf width1.5 mm
Leaf width max2.5 mm
Leaf width min0.3 mm
Plant height0.19 m
⚠ sources differ — GIFT: 0.19 m · AusTraits: 0.4 m · LEDA: 0.175 m · TRY: 0.06 m
Plant height generative0.225 m
Plant height max1 m
Plant height min0.05 m
Seed length0.89 mm
Seed length max0.9 mm
Seed length min0.7 mm
Seed mass0.118 mg
⚠ sources differ — TRY: 0.118 mg · AusTraits: 0.01 mg · LEDA: 0.1 mg · GIFT: 0.111 mg
Seed mass max0.14 mg
Seed mass min0.079 mg
Seed volume0.082 mm³
Seed volume max0.082 mm³
Seed volume min0.082 mm³
Seed width1.5 mm
Life cycle & reproduction20
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dehiscencedehiscent
Dispersal typewind
⚠ sources differ — AusTraits: anemochory · LEDA: agochor · GIFT: unspecialized
Flower colourpink
Flower length max6 mm
Flower length min4 mm
Flowering endOct
Flowering startJan
Flowering timeynnnnnnnyyyy
Life formannual or subshrub
Life spanperennial
Lifespan years2.5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formchamaephyte
Reproduction asexualabsent
Resprouting capacityresprouts
Seed number1 974
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 800 m
Elevation mean1 200 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTCoastal
Leaf compoundnesssimple
Leaf shapelinear
Mycorrhiza typearbuscular
Succulenceyes
Woodinessnon-woody
Physiology & chemistry8
Leaf c340 mg/g
Leaf dry-matter content (LDMC)121 mg/g
⚠ sources differ — TRY: 121 mg/g · LEDA: 109 mg/g
Leaf n14.42 mg/g
Leaf p1.19 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)29.39 mm²/mg
Other traits5
Diaspore typeone-seeded generative dispersule
Leaf arrangementopposite
Shoot length max50 cm
Shoot length min5 cm
Shoot orientationascending
05DNA & barcoding22 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spergularia media has left across the world's sequence archives.
At a glance
DNA specimens22
Marker genes5
GenBank sequences10
eDNA detections10
Countries5
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCCTCGGGCTTAGGGCACGTCTGCCTGGGCGTCACGCATC …
Spergularia media voucher 64669HIM 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL2★rbcLa★ITS5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Spergularia media carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size322 740 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Spergularia media0.32 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidydiploid inferred
Chromosome records18–722n range18median18mode69records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1860×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +12
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Kochjarová J., 1992: Karyological study of the Slovak flora XXVIII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 39: 67-74.
CCDB · brit-fl — Blackburn, K.B., Morton, J.K. New Phytol. 56: 344-351 (1957)
CCDB · brit-fl — Ratter, J.A. Notes Roy. Bot. Gard. Edinburgh 25: 293-302 (1964)
CCDB · iber-fl — The incidence of polyploidy in the Caryophyllaceae of Britain and of Portugal. Blackburn, K. B. & J. K. Morton.New Phytol.56: 344-351(1957).
CCDB · iber-fl — Primeiro contacto citolgico com a flora halfila dos salgados de Sacavm. Castro, D. & F. Carvalho Fontes.Brotria Ci. Nat.15(1): 38-46(1946).
CCDB · iber-fl — Cytogenetic studies in Spergularia, I. Cytology of some old world species. Ratter, J. A.Notes Roy. Bot. Gard. Edinburgh25(3): 293-302(1964).
CCDB · iber-fl — Chromosome numbers in Iberian angiosperms. Bjorkqvist, I. & al.Bot. Not.122: 271-283(1969).
CCDB · iber-fl — Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Luque, T. & Z. Daz Lifante.Bocconea1: 303-364(1991).
CCDB · iber-fl — Estudio citotaxonmico de la flora de las costas gallegas Lago Canzobre, E. & S. Castroviejo.Cadernos rea Ci. Biol.3: 1-215(1993).
CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1954
CCDB · fl-europaea — Ratter, 1964
CCDB · mediterranean
CCDB · ipcn-api-dl — Ratter, J. A. 1973. Cytogenetic studies in Spergularia: VII Cryptic speciation in S. media (L.) C. Presl and S. marina (L.) Griseb. Notes Roy. Bot. Gard. Edinburgh 32: 291–296.
CCDB · ipcn-api-dl — Gukasian, A. G. & A. B. Safarian. 1990. Chromosome numbers of some representatives of Armenian flora. Biol. Zurn. Armen. 43: 259–260.
CCDB · ipcn-api-dl — Luque, T. & Z. D. Lifante. 1991. Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303–364.
CCDB · ipcn-api-dl — Kochjarová, J. 1992. Karyological study of the Slovak flora XXVIII. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 39: 67–74.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — LOON VAN, J. C. & H. D. JONG. 1978. In IOPB chromosome number reports LIX. Taxon 27: 53–61.
CCDB · ipcn-api-dl — Dvorak, F. & B. Dadakova. 1978a. In IOPB chromosome number reports LXI. Taxon 27: 375–392.
CCDB · ipcn-api-dl — LABADIE, J. 1976a. Contribution à l'etude caryosystematique des espeees halophiles du littoral languedocier (plus precisement, especes appartenant à la classe des Salicornietea). These, Universite du Languedoc. 222 pp.
CCDB · ipcn-api-dl — Runemark, H. 1996. Mediterranean chromosome number reports 6 (590--678). Fl. Medit. 6: 223–243.
CCDB · ipcn-api-dl — Petrova, A. 1995. Mediterranean chromosome number reports 5 (415--434). Fl. Medit. 5: 279–288.
CCDB · book-ipcn67-71 — STERK, A.A. 1969. Biosystematic studies on Spergularia media and Spergularia marina in the Netherlands IV. Reproduction, disseminatic karyogenetics and taxonomy. Acta Bot. Neerl. 18: 639-650.
CCDB · book-ipcn67-71 — BJ.ORKQVIST, I . , R. VON BOTHMER, O. NILSSON: & B. NORDENSTAM. 1969. Chromosome numbers in Iberian Angiosperms. Bot. Notiser 122: 271-28;
CCDB · book-northern-plants — Castro & Fontes 1946, Nordenskiiild (L. & L. 1942 b).
CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.
CCDB · eflora
CCDB · book-fedorov — Nordenskiold (LOve A., Love D. 1942b)
CCDB · book-fedorov — Reese 1957
CCDB · book-fedorov — Tischler 1937
CCDB · book-fedorov — Wulff 1937n
CCDB · book-fedorov — Roinvcdor 1939
CCDB · book-fedorov — Castro, Fontes 1946
CCDB · book-fedorov — D. 1955)
CCDB · book-fedorov — Larsen 19!l0h
CCDB · book-fedorov — Monnier 1960b
CCDB · book-fedorov — Hair 1963
CCDB · book-atlas-flowering-plants — Castro & F. 1946
+18 more references
2n 366×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · fl-europaea +2
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Blackburn, K.B., Morton, J.K. New Phytol. 56: 344-351 (1957)
CCDB · fl-europaea — Blackburn &
CCDB · Cave1963 — Monnier 1962
CCDB · CromoCat 2015 — Fernandes, A. & Leitão, M. T. (1971). Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. III. Caryophyllaceae. Bol. Soc. Brot. 45: 143-176.
CCDB · CromoCat 2015 — Monnier, P. (1975). Systématique et biosystématique de G. Spergularia dans le bassin mediterranéen occidental (Essai de taxonomie synthètique) III Section des S. marginata. Candollea 30: 121-155.
2n 723×CCDB · new-zealand · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · new-zealand
CCDB · ipcn-api-dl — de Lange, P. J., B. G. Murray & P. M. Datson. 2004. Contributions to a chromosome atlas of the New Zealand flora---38. Counts for 50 families. New Zealand J. Bot. 42: 873–904.
CCDB · CromoCat 2015 — de Lange, P. J., B. G. Murray & P. M. Datson (2004). Contributions to a chromosome atlas of the New Zealand flora—38. Counts for 50 families New Zealand J. Bot. 42: 873–904
n 99×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · iber-fl — Cytogenetic studies in Spergularia, I. Cytology of some old world species. Ratter, J. A.Notes Roy. Bot. Gard. Edinburgh25(3): 293-302(1964).
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · book-ipcn67-71 — STERK, A.A. 1969. Biosystematic studies on Spergularia media and Spergularia marina in the Netherlands IV. Reproduction, disseminatic karyogenetics and taxonomy. Acta Bot. Neerl. 18: 639-650.
CCDB · Cave1957 — Reese
CCDB · CromoCat 2015 — Ratter, J. A. (1964). Cytogenetic studies in Spergularia, I. Cytology of some old world species. Notes Roy. Bot. Gard. Edinburgh 25(3): 293-302.
CCDB · CromoCat 2015 — Khatoon, S. & Ali, S. I. (1993). Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi
n 183×CCDB · Cave1963 · CCDB · CromoCat 2015
CCDB · Cave1963 — Monnier 1962
CCDB · Cave1963 — Hair 1963
CCDB · CromoCat 2015 — Hair, J. B. (1963). Contributions to a chromosome atlas of the New Zealand flora 6. Miscellaneous Families. New Zealand J. Bot. 1(3): 243-257.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type37 519 records
Wild obs. + sensor35 011
Museum / vouchered2 446
Cultivated / captive16
Other46
Origin
Native4 759
Introduced145
Range
Area of Occupancy AOO37 248 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy53% within 1 km
≤100 m 11 801≤1 km 5 947≤10 km 15 798>10 km 35
33 581 georeferenced · 1 430 without coordinates
Open the mapobservation + sensor35 011
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy58% within 1 km
≤100 m 235≤1 km 400≤10 km 394>10 km 71
1 100 georeferenced · 1 346 without coordinates
Open the institutions mapphysical evidence2 446
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy19% within 1 km
≤1 km 3>10 km 13
16 georeferenced
Open the mapnot free-living16
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions71 of 132 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| South Kensington, GB | 359 |
| LDlocation not on record | 242 |
| Olocation not on record | 141 |
| Pretoria, ZA | 123 |
| MAlocation not on record | 81 |
| València, ES | 76 |
| Christchurch, NZ | 76 |
| Cape Town, ZA | 74 |
| Museo Entomologico de Leonlocation not on record | 70 |
| Moscow State Universitylocation not on record | 67 |
| BIO-UNIPIlocation not on record | 65 |
| Wellington, NZ | 58 |
| Trondheim, NO | 58 |
| Bergen, NO | 57 |
| Oskarshamn, SE | 55 |
| BClocation not on record | 51 |
| SLU Artdatabankenlocation not on record | 51 |
| Adelaide, AU | 38 |
| BDBClocation not on record | 38 |
| San Sebastián, ES | 30 |
| MeiseBGlocation not on record | 29 |
| Chongqing Museumlocation not on record | 21 |
| Alicante, ES | 19 |
| KMNlocation not on record | 17 |
| Barcelona, ES | 16 |
| TROMlocation not on record | 16 |
| Granada, ES | 15 |
| CJBGlocation not on record | 15 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 14 |
| DBF-NHMDlocation not on record | 14 |
| Denver, US | 14 |
| Berlin, DE | 14 |
| BRNUlocation not on record | 12 |
| Salamanca, ES | 10 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 10 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 10 |
| Canberra, AU | 10 |
| Görlitz, DE | 10 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 9 |
| Nunoa, Santiago, CL | 9 |
| Brisbane, AU | 9 |
| Tilburg, NL | 8 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 8 |
| Pamplona, ES | 7 |
| Helsinki, FI | 7 |
| Durban, ZA | 7 |
| College of the Atlantic, Museumlocation not on record | 7 |
| UIBlocation not on record | 7 |
| Auckland, NZ | 6 |
| Entomological Society of Latvialocation not on record | 6 |
| Wlocation not on record | 6 |
| Badajoz, ES | 6 |
| Uppsala, SE | 6 |
| Phyletisches Museum Jenalocation not on record | 5 |
| BSBIlocation not on record | 5 |
| GHPG$location not on record | 5 |
| Hobart, AU | 5 |
| Madrid, ES | 5 |
| MSB-3054location not on record | 4 |
| Philadelphia, US | 4 |
| Bloomington, US | 4 |
| Bronx, US | 3 |
| National Museum Waleslocation not on record | 3 |
| Tartu, EE | 3 |
| Museo Achille Folettolocation not on record | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Kew, GB | 3 |
| NMBU:MINAlocation not on record | 3 |
| Mount Annan, AU | 3 |
| Montréal, CA | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| CICYTEXlocation not on record | 3 |
| Burlington, US | 2 |
| Beijing, CN | 2 |
| La Trobe Universitylocation not on record | 2 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 2 |
| Philadelphia, US | 2 |
| Provincia di Livornolocation not on record | 2 |
| Wuzhou, CN | 2 |
| Xining, CN | 2 |
| Emporia, US | 2 |
| Porrentruy, CH | 2 |
| Tampa, US | 2 |
| Frankfurt am Main | 2 |
| Pullman, US | 2 |
| Staten Island, US | 2 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 2 |
| Lanzhou, CN | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| Stockholm, SE | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Mississippi State, US | 2 |
| Sion, CH | 1 |
| BG-NMNHSlocation not on record | 1 |
| OLAlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| Armidale, AU | 1 |
| Mlocation not on record | 1 |
| New Brunswick, US | 1 |
| Pamplona, ES | 1 |
| University of Stellenboschlocation not on record | 1 |
| Saint Louis, US | 1 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 1 |
| Green Bay, US | 1 |
| Dekalb, US | 1 |
| Bratislava, SK | 1 |
| Parkville, AU | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Bourges, FR | 1 |
| Chadron, US | 1 |
| Logan, US | 1 |
| Chicago, US | 1 |
| PRClocation not on record | 1 |
| GJOlocation not on record | 1 |
| nbflocation not on record | 1 |
| Xiamen, CN | 1 |
| EEZA-CSIClocation not on record | 1 |
| Vancouver, CA | 1 |
| STUlocation not on record | 1 |
| ISAlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| La Paz, MX | 1 |
| Edinburgh, GB | 1 |
| Ensenada, MX | 1 |
| Acadia Universitylocation not on record | 1 |
| Paris, FR | 1 |
| Smithfield, AU | 1 |
| Sede dell'Orto botanico del Museo di Storia naturale dell'Università degli Studi di Parmalocation not on record | 1 |
| IWEP FEB RASlocation not on record | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| Hunan Geological Museumlocation not on record | 1 |
132 institutions · 2 334 of 2 446 vouchered records shown · 112 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA10 detections
Where the DNA of Spergularia media was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map3 countries0
on coastal mud plain
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.9 °C 11.8–17.9
Seasonal swing summer↔winter12.2 °C
Max temp (day)17.3 °C 13.9–20.9
Min temp (night)13.7 °C 9.20–15.6
Precipitation79.9 mm/mo 61.3–145
Air humidity62.9 % 60.9–65.9
Moisture balance-43.6 mm/mo
Vapour deficit665 Pa 510–786
Wind speed5.60 m/s
Cloud cover48.2 % 38.7–51.1
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.