Spathiphyllum wallisii

Regel · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Spathiphyllum

At a glance

Occurrence records401

Data sources11

Biological traits12

DNA specimens10

eDNA detections6

Sources11 archives

Databases and archives Spathiphyllum wallisii's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility401 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionNPASS4 compounds

Occurrence & distributionGBIF401 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 30

01Narrative

Spathiphyllum wallisii, commonly known as peace lily, white sails, or spathe flower is a very popular indoor house plant of the family Araceae. The genus name means "spathe-leaf", and the specific epithet is named after Gustav Wallis, the German plant collector.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation mean1 465 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition4 compounds

Compounds documented for Spathiphyllum wallisii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavanones4

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-(2S)-5,2'-Dihydroxy-6'',6''-Dimethylchromeno-(7,8:2'',3'')-3'-Prenylflavanone	present	NPASS
(-)-(2S)-5,7,2'-Trihydroxy-5'-(1''',1'''-Dimethylallyl)-8-Prenylflavanone	present	NPASS
(-)-(2S)-5,7,2'-Trihydroxy-8,3'-Diprenylflavanone	present	NPASS
Obovatin	present	NPASS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spathiphyllum wallisii has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes7

GenBank sequences9

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOL435809.1 ↗751 bp

ACGT

CATTGTCGTATCCTGCCACGACACACGTGAACGGTTGAACCCGAAATTGAACGGGGGGTAGGGGCAAAGGTTGGCAAGCCGACCGGACAG …

Spathiphyllum wallisii voucher Tippery 1258 (UWW) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK4★rbcL4★rbcLa★ITS1rpoBtrnH-psbA

animal barcodeplant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Spathiphyllum wallisii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidypolyploid inferred

Chromosome records30–302n range30median30mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 302×CCDB · book-ipcn73-74 · CCDB · araceae

CCDB · book-ipcn73-74 — MARCHANT, C.J. 1973. Chromosome variation in the Araceae: V. Acorede to Lasieae. Kew Bull. 28: 199-210.

CCDB · araceae — Petersen, 1989

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.535 ↗

08Occurrence & distribution

Record type401 records

Wild obs. + sensor310

Museum / vouchered87

Cultivated / captive4

Range

Area of Occupancy AOO1 232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 172≤1 km 39≤10 km 20>10 km 19

250 georeferenced · 60 without coordinates

Open the mapobservation + sensor310

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 7≤1 km 5≤10 km 6>10 km 3

21 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence87

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 46 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cascavel, BR	9
Auckland, NZ	6
Universidad de Caldas (UCaldas)location not on record	4
Bronx, US	4
Puerto Ayora, EC	4
Durango, MX	4
Salvador, BR	4
Saint Louis, US	4
Museo naturalistico del Frignano Ferruccio Minghellilocation not on record	3
Chongqing Museumlocation not on record	3
Millersville, US	2
Mexico City, MX	2
Kew, GB	2
CEPLAClocation not on record	2
WTUlocation not on record	1
UNESP-RClocation not on record	1
Dekalb, US	1
UFBAlocation not on record	1
Québec, CA	1
Ilhéus, BR	1
Philadelphia, US	1
Provincia di Livornolocation not on record	1
Jataí / Setor Industrial, BR	1
Universidade Federal de Santa Catarinalocation not on record	1
Campo Mourão, BR	1
PHlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Universidad Industrial de Santander (UIS)location not on record	1
Bangkok, TH	1
Universidade do Estado de Mato Grossolocation not on record	1
Universidad Nacional Autónoma de Honduraslocation not on record	1
Vitoria, ES	1
JBRJlocation not on record	1
Minia, EG	1
Paleontological Collectionlocation not on record	1
Universidad de Antioquia (UdeA)location not on record	1
UNITINSlocation not on record	1
Museu Paraense Emílio Goeldilocation not on record	1
Universidad Nacional de Colombia (UNAL)location not on record	1
Pontifícia Universidade Católica do Paranálocation not on record	1
UFRPElocation not on record	1
UNIVILLElocation not on record	1
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
UFSClocation not on record	1
UTFPR-CPlocation not on record	1
UEMlocation not on record	1

46 institutions · 85 of 87 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Spathiphyllum wallisii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 14.9–17.9

Seasonal swing summer↔winter15.6 °C

Max temp (day)20.1 °C 19.1–21.1

Min temp (night)12.1 °C 9.90–14.4

Precipitation37.7 mm/mo 10.0–65.3

Air humidity59.1 % 58.4–59.7

Moisture balance-82.0 mm/mo -131–-32.9

Vapour deficit811 Pa 788–834

Wind speed3.60 m/s 2.80–4.50

Cloud cover36.1 % 32.2–39.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)