Spathacanthus hahnianus — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Acanthaceae/Spathacanthus

At a glance

Occurrence records69

Data sources6

Biological traits5

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Spathacanthus hahnianus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility69 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources5 traits

Occurrence & distributionGBIF69 records

DNA & barcodingNCBIsequences

01Narrative

Spathacanthus hahnianus is a species of plant in the family Acanthaceae. It is found in Costa Rica, Guatemala, Honduras, Mexico, and Nicaragua. It is threatened by habitat loss. This species occurs in cloud forests and tropical rainforests, rarely in oak forests, and mostly around streams. It is found at elevations between 150 and 1,650 meters.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formshrub or tree

Life spanperennial

Habitat & environment3

Climatewet tropical

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Tree/Treelet

Woodinesswoody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spathacanthus hahnianus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOP711519.1 ↗531 bpMexico

ACGT

TACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCG …

Spathacanthus hahnianus voucher Canek Ledesma 21001 (MEXU, US) ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1

plant barcode

08Occurrence & distribution

Record type69 records

Wild obs. + sensor5

Museum / vouchered64

Range

Area of Occupancy AOO192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 5

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 37≤1 km 1

38 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Austin, US	15
Mexico City, MX	13
Durango, MX	13
Mexico City, MX	5
San Francisco, US	4
Tuxtla Gutiérrez, MX	4
Saint Louis, US	3
Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record	2
Tapachula, MX	2
Chicago, US	1
University of Stellenboschlocation not on record	1

11 institutions · 63 of 64 vouchered records shown · 1 without an institution code