Spatalla confusa

(E.Phillips) Rourke · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Spatalla

At a glance

Occurrence records299

Data sources8

Biological traits14

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Spatalla confusa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility299 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF299 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Spatalla confusa the long-tube spoon is a flowering shrub native to the Western Cape where it forms part of the fynbos.* It is found in the Cederberg up to the Hottentots Holland Mountains, Swartberg and Kammanassie Mountains*

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max1 m

Plant height min0.5 m

Life cycle & reproduction2

Life formsubshrub or shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 200 m

Elevation min1 200 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spatalla confusa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF508832.1 ↗618 bp

ACGT

ATTGTCGATACCTGCCCAGCAGAGAGACCCGCGAACACGTTGCATCTTGATCGGGGGTGGGGGGCTCATACCCTTCACCCCTTTATGGTC …

Spatalla confusa internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type299 records

Wild obs. + sensor149

Museum / vouchered150

Range

Area of Occupancy AOO444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 130≤1 km 6≤10 km 3

139 georeferenced · 10 without coordinates

Open the mapobservation + sensor149

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 149 without coordinates

Open the institutions mapphysical evidence150

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	72
Pretoria, ZA	57
Cape Town, ZA	16
Paris, FR	3
Claremont, US	1

5 institutions · 149 of 150 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Spatalla confusa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)