Sparganium natans
speciesAt a glance
Occurrence records36 304
Data sources11
Biological traits45
DNA specimens36
eDNA detections20
Sources11 archives
Databases and archives Sparganium natans's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility36 304 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics36 specimens↗
NCBIUS National Library of Medicinesequences↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources45 traits
Occurrence & distributionGBIF36 304 records
Environmental DNA1 datasets · 5 countries20 detections
DNA & barcodingBOLD · NCBI36 specimens
Genome at a glanceCCDB606 Mbp
01Narrative
Sparganium natans, de nom commun Rubanier nain, est une plante de la famille des spargianacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology11
Leaf length225 mm
Leaf length max250 mm
Leaf length min200 mm
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · GIFT: 511 mm²
Leaf width4 mm
Plant height0.066 m
⚠ sources differ — GIFT: 0.066 m · TRY: 0.4 m
Plant height generative0.2 m
Plant height max1 m
Plant height min0.015 m
Seed length4.94 mm
Seed mass2.05 mg
⚠ sources differ — TRY: 2.05 mg · GIFT: 2.6 mg
Life cycle & reproduction13
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typewater
Flowering endAug
Flowering startJun
Life formhelophyte
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formcryptophyte
Reproduction asexualabsent
Self fertilizationpresent
Sex typemonoecious
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticaquatic
Climatetemperate
Climberself-supporting
Elevation max441 m
Elevation mean1 941 m
Elevation min3 441 m
Epiphyteterrestrial
Fruit typedrupe
Growth formherb
⚠ sources differ — GIFT: herb · TRY: hydrophyte
Habitat GIFTcanals, lakes, swamps
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry6
Leaf C:N ratio12.32 g/g
Leaf c454 mg/g
Leaf dry-matter content (LDMC)176 mg/g
Leaf n38.33 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)39.88 mm²/mg
Other traits1
Diaspore typeone-seeded generative dispersule
05DNA & barcoding36 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sparganium natans has left across the world's sequence archives.
At a glance
DNA specimens36
Marker genes7
GenBank sequences10
eDNA detections20
Countries6
The DNA barcodea real sequence read deposited for this species
TAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGATACCCGACCAAGACGACCCGCGAACTCG …
Sparganium natans voucher J. Sulman & E. McGrath 891 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL6★rbcLa★trnL-F★ITS1★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Sparganium natans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size606 360 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Sparganium natans0.61 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 30 n = 15
Ploidy2× diploid · measured
Chromosome records30–302n range30median30mode15records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3015×CCDB · slov-fl · CCDB · nw-europe-fl · CCDB · fl-europaea +8
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4717
CCDB · fl-europaea — LBve & Lbve, 1956
CCDB · poland — Bijok K., and Adamkiewicz E. 1971. Badania kariologiczne nad dwoma gatunkami rodzaju Sparganium L. Acta. Soc. Bot. Pol. 40, 143-148.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981b. In Chromosome number reports LXXII. Taxon 30: 699–701.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — BIJOK, K., & E. ADAMKIEWICZ. 1971. Badania karidogiczne nad dwona gatunkami rodzaju Sparganium L. [Karyological studies in two species of the genus Sparganiuml Acta soc. Bot. Poloniae 40: 143-148.
CCDB · eflora
CCDB · book-fedorov — Wulff 1938
CCDB · book-fedorov — Lohammar (Love A., Love D. 1942bJ
CCDB · book-fedorov — LOve A., LOve D. 1956b
CCDB · book-atlas-flowering-plants — 1938
CCDB · Cave1956 — Love & Love b
CCDB · iapt — IAPT/IOPB Chromosome Data 26
n 151×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type36 304 records
Wild obs. + sensor29 385
Museum / vouchered6 873
Cultivated / captive10
Fossil1
Other35
Origin
Native2 362
Range
Area of Occupancy AOO84 900 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy61% within 1 km
≤100 m 9 739≤1 km 7 228≤10 km 10 845>10 km 193
28 005 georeferenced · 1 380 without coordinates
Open the mapobservation + sensor29 385
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy44% within 1 km
≤100 m 587≤1 km 1 403≤10 km 1 429>10 km 1 103
4 522 georeferenced · 2 351 without coordinates
Open the institutions mapphysical evidence6 873
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 7
7 georeferenced · 3 without coordinates
Open the mapnot free-living10
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions94 of 175 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Helsinki, FI | 910 |
| Olocation not on record | 558 |
| LDlocation not on record | 535 |
| Moscow State Universitylocation not on record | 303 |
| Oulu, FI | 270 |
| Trondheim, NO | 257 |
| Uniwersytet Wrocławskilocation not on record | 223 |
| Zürich, CH | 184 |
| SLU Artdatabankenlocation not on record | 170 |
| Tartu, EE | 169 |
| Zürich, CH | 163 |
| Bergen, NO | 160 |
| Uppsala, SE | 138 |
| MeiseBGlocation not on record | 128 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 117 |
| Oskarshamn, SE | 115 |
| Brussel, BE | 112 |
| TROMlocation not on record | 111 |
| Turku, FI | 107 |
| KMNlocation not on record | 85 |
| BFLlocation not on record | 81 |
| Görlitz, DE | 67 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 64 |
| Université Lavallocation not on record | 63 |
| St. Paul, US | 51 |
| TUR-Alocation not on record | 50 |
| Ann Arbor, US | 48 |
| Bern, CH | 47 |
| Jyväskylä, FI | 44 |
| Salzburg, AT | 43 |
| Dresden, DE | 43 |
| Garðabær, IS | 43 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 40 |
| Chicago, US | 40 |
| Madison, US | 39 |
| DBF-NHMDlocation not on record | 39 |
| Toronto, CA | 35 |
| Victoria, CA | 32 |
| Montréal, CA | 31 |
| Kuopio, FI | 29 |
| University of New Hampshirelocation not on record | 28 |
| Saint John, CA | 27 |
| 25 | |
| Pullman, US | 25 |
| Irkutsk State Universitylocation not on record | 24 |
| Acadia Universitylocation not on record | 23 |
| University of Alberta Museumslocation not on record | 22 |
| Mlocation not on record | 22 |
| Burlington, US | 20 |
| Missoula, US | 20 |
| Kandalaksha State Nature Reservelocation not on record | 19 |
| WTUlocation not on record | 19 |
| Chongqing Museumlocation not on record | 18 |
| Corvallis, US | 17 |
| Institute of the biological problems of the North FEB RASlocation not on record | 17 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 16 |
| Provincia di Livornolocation not on record | 15 |
| NMBU:MINAlocation not on record | 14 |
| South Kensington, GB | 14 |
| CJBGlocation not on record | 12 |
| Green Bay, US | 12 |
| Vancouver, CA | 11 |
| Tula State Universitylocation not on record | 11 |
| Moscow, US | 11 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 10 |
| WINlocation not on record | 9 |
| Rovaniemi, FI | 9 |
| Québec, CA | 9 |
| Frankfurt am Main | 9 |
| Porvoo, FI | 9 |
| nbflocation not on record | 8 |
| Lausanne, CH | 8 |
| Tallinn, EE | 8 |
| BRNUlocation not on record | 7 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 7 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 7 |
| McWane Science Centerlocation not on record | 6 |
| Claremont, US | 6 |
| UGentlocation not on record | 5 |
| Whitehorse, CA | 5 |
| Tilburg, NL | 5 |
| BSBIlocation not on record | 5 |
| Flagstaff, US | 5 |
| Bloomington, US | 5 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 5 |
| Frauenfeld, CH | 5 |
| Auckland, NZ | 4 |
| Anchorage, US | 4 |
| Wuzhou, CN | 4 |
| Tromso University Museumlocation not on record | 4 |
| University of Hamburglocation not on record | 4 |
| Wlocation not on record | 4 |
| MAlocation not on record | 4 |
| Bronx, US | 3 |
| Stockholm, SE | 3 |
| National Museum Waleslocation not on record | 3 |
| Philadelphia, US | 3 |
| University of Manitoba Herbariumlocation not on record | 3 |
| US | 3 |
| Berlin, DE | 3 |
| Umeå Universitylocation not on record | 3 |
| BIO-UNIPIlocation not on record | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Davis, US | 3 |
| Denver, US | 3 |
| CASlocation not on record | 2 |
| Forssa, FI | 2 |
| Göteborg, SE | 2 |
| Tsukuba, JP | 2 |
| Fulda, DE | 2 |
| Metsähallituslocation not on record | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| US | 2 |
| Provo, US | 2 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 2 |
| Sion, CH | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| Yukon Universitylocation not on record | 2 |
| Hokkaido University Botanic Gardenlocation not on record | 2 |
| Dekalb, US | 2 |
| Glarus, CH | 2 |
| València, ES | 2 |
| Portland, US | 2 |
| Boise, US | 2 |
| Lubbock, US | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| PRClocation not on record | 2 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 2 |
| Durham, US | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| GJOlocation not on record | 1 |
| Jackson, US | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Northridge, US | 1 |
| H-Meierottlocation not on record | 1 |
| Madrid, ES | 1 |
| Grand Junction, US | 1 |
| Fribourg, CH | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| University of Hulllocation not on record | 1 |
| Centre for Biodiversity Genomicslocation not on record | 1 |
| Moscow University Herbarium (MW)location not on record | 1 |
| BClocation not on record | 1 |
| Salamanca, ES | 1 |
| Whitewater, US | 1 |
| Philadelphia, US | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Mount Pleasant, US | 1 |
| ER Hellerlocation not on record | 1 |
| Beijing, CN | 1 |
| Logan, US | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Xiamen, CN | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| E|HLU|Klocation not on record | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| CEPLAClocation not on record | 1 |
| Durango, US | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| DULlocation not on record | 1 |
| Saint Louis, US | 1 |
| Chadron, US | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Tacoma, US | 1 |
| Nijmegen, NL | 1 |
| Wellington, NZ | 1 |
| Granada, ES | 1 |
| NMWlocation not on record | 1 |
| Cheney, US | 1 |
| Museum Wiesbadenlocation not on record | 1 |
| Pittsburg, US | 1 |
| Caldwell, US | 1 |
| Henderson, US | 1 |
175 institutions · 6 499 of 6 873 vouchered records shown · 371 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA20 detections
Where the DNA of Sparganium natans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found20
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 20 detections have coordinates
Open the map5 countries0
in mud at edge of pond
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.7 °C 10.0–15.8
Seasonal swing summer↔winter23.2 °C
Max temp (day)15.4 °C 12.2–19.2
Min temp (night)9.20 °C 6.40–12.5
Precipitation93.9 mm/mo 69.8–132
Air humidity62.7 % 58.7–67.1
Moisture balance10.4 mm/mo -53.8–61.1
Vapour deficit521 Pa 427–768
Wind speed2.60 m/s 1.90–5.10
Cloud cover51.0 % 43.4–65.3
CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.