Sparaxis pillansii

L.Bolus · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Sparaxis

At a glance

Occurrence records75

Data sources7

Biological traits17

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Sparaxis pillansii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility75 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources17 traits

Occurrence & distributionGBIF75 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 20

01Narrative

Sparaxis pillansii, is a species of Sparaxis found in Northern Cape, South Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology4

Plant height0.4 m

Plant height max0.44 m

Plant height min0.2 m

Seed mass11.81 mg

Life cycle & reproduction4

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 000 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sparaxis pillansii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPQ191173.1 ↗717 bpUSA · 2023

ACGT

ATGTCACCACAAACAGAGACTAAAGCAAGTGCTGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCGGAGTACGAA …

Sparaxis pillansii voucher 72.0231 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Sparaxis pillansii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 202×CCDB · book-ipcn67-71 · CCDB · Oberlander2016

CCDB · book-ipcn67-71 — GOLDBLATT, P. 1971. Cytological and morphological studies in the Southern African Iridaceae. J.S. African Bot. 37: 317-460.

CCDB · Oberlander2016 — Brittingham, 1934

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type75 records

Wild obs. + sensor20

Museum / vouchered55

Origin

Introduced1

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 11≤1 km 2>10 km 3

16 georeferenced · 4 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 7≤1 km 1≤10 km 20

28 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	26
Cape Town, ZA	17
Pretoria, ZA	5
Canberra, AU	3
Museo Entomologico de Leonlocation not on record	1
MSB-3054location not on record	1
Saint Louis, US	1
BGPAlocation not on record	1

8 institutions · 55 of 55 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)