Sparassis spathulata

(Schwein.) Fr. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Polyporales/Sparassidaceae/Sparassis

At a glance

Occurrence records3 111

Data sources9

Biological traits0

DNA specimens4

eDNA detections4

Sources9 archives

Databases and archives Sparassis spathulata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 111 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 111 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Sparassis spathulata is a species of fungus in the genus Sparassis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sparassis spathulata has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences10

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV070457.1 ↗520 bpUSA · 2024

ACGT

GTAACGCGTCGATATATATATGTGTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA …

Sparassis spathulata voucher UNCA00254 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type3 111 records

Wild obs. + sensor3 035

Museum / vouchered76

Range

Area of Occupancy AOO9 152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 1 428≤1 km 345≤10 km 474>10 km 324

2 571 georeferenced · 464 without coordinates

Open the mapobservation + sensor3 035

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 2≤1 km 9≤10 km 21>10 km 6

38 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence76

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TENN-Flocation not on record	22
Davis and Elkins Collegelocation not on record	11
Bernard Price Institute for Palaeontological Researchlocation not on record	10
Blacksburg, US	6
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	4
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	3
Chicago, US	3
Durham, US	1
Bronx, US	1
Chapel Hill, US	1
Brown Universitylocation not on record	1
Kew, GB	1
MeiseBGlocation not on record	1
Laramie, US	1
Karlsruhe, DE	1
Catholic University of Pekinglocation not on record	1
Copenhagen, DK	1
PHlocation not on record	1
Colorado State Universitylocation not on record	1
Madison, US	1

20 institutions · 72 of 76 vouchered records shown · 4 without an institution code

09Environmental DNA4 detections

Where the DNA of Sparassis spathulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sparassis spathulata

At a glance

Sources9 archives

At a glance

Record type3 111 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type3 111 records