Sowerbyella radiculata

(Sowerby) Nannf. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Pezizomycetes/Pezizales/Pyronemataceae/Sowerbyella

At a glance

Occurrence records525

Data sources9

Biological traits0

DNA specimens2

eDNA detections3

Sources9 archives

Databases and archives Sowerbyella radiculata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility525 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF525 records

Environmental DNA2 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Sowerbyella radiculata is a species of apothecial fungus belonging to the family Pyronemataceae. The typical form appears as yellowish cups up to 5 cm in diameter usually on soil close to coniferous trees. A distinctive form, var. kewensis, is usually larger (up to 10 cm across) and often associated with broad-leaved trees. This is an uncommon European species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sowerbyella radiculata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences5

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPV031060.1 ↗529 bpUnited Kingdom · 2022

ACGT

CTGCGGAAGGATCATTAAAAGAAATAGTGTGTCCCGCAATGGATGCTCATTCTACACCCACCCTGTGTACCTGTCCTGTTGCTTCCTCGA …

Sowerbyella radiculata voucher HFRG_EJ221104_1_FRDBI_28687876 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

08Occurrence & distribution

Record type525 records

Wild obs. + sensor326

Museum / vouchered199

Range

Area of Occupancy AOO1 292 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy30% within 1 km

≤100 m 56≤1 km 40≤10 km 217>10 km 2

315 georeferenced · 11 without coordinates

Open the mapobservation + sensor326

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 26≤1 km 28≤10 km 19>10 km 17

90 georeferenced · 109 without coordinates

Open the institutions mapphysical evidence199

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Copenhagen, DK	50
Uppsala, SE	28
Olocation not on record	19
Kew, GB	18
Berlin, DE	13
SLU Artdatabankenlocation not on record	9
Philadelphia, US	6
Oulu, FI	3
WU-MYClocation not on record	3
TROMlocation not on record	2
Tilburg, NL	2
Universidade de Lisboa, Museu Bocagelocation not on record	2
Helsinki, FI	2
Royal Botanic Gardens, Kewlocation not on record	1
Tartu, EE	1
Turku, FI	1
FAMCALlocation not on record	1
Trondheim, NO	1
Adam Mickiewicz University in Poznańlocation not on record	1
LDlocation not on record	1
Catholic University of Pekinglocation not on record	1
Göteborg, SE	1
nsnflocation not on record	1

23 institutions · 167 of 199 vouchered records shown · 32 without an institution code

09Environmental DNA3 detections

Where the DNA of Sowerbyella radiculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

Palearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median4.30 °C 3.70–4.80

Seasonal swing summer↔winter20.8 °C

Max temp (day)6.90 °C 6.70–7.10

Min temp (night)0.6 °C -0.7–1.80

Precipitation108 mm/mo 68.4–148

Air humidity67.4 % 67.2–67.6

Moisture balance66.4 mm/mo 45.4–87.3

Vapour deficit303 Pa 288–318

Wind speed3.30 m/s 3.20–3.40

Cloud cover48.1 % 46.4–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)