Soterosanthus shepheardii

(Rolfe) Jenny · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Soterosanthus

At a glance

Occurrence records14

Data sources7

Biological traits10

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Soterosanthus shepheardii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF14 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Soterosanthus shepheardii is a species of orchid found in Ecuador and Colombia, and the only species of the monotypic genus Soterosanthus. This species segregated from Sievekingia because of its upright inflorescence. Flowers are somewhat similar to Sievekingia as is the plant stature, being on the small side, around 6" tall. Plants are semi-deciduous and warmth tolerant. Grow in small pots of medium grade bark mix under same conditions as for Gongora; shaded light, even moisture, drier in winter. It is a rarely seen relative of Stanhopea.Pridgeon, A.M., Cribb, P.J., Chase, M.C. & Rasmussen, F.N. (2009). Epidendroideae (Part two). Genera Orchidacearum 5: 1-585. Oxford University Press, New York, Oxford.Jenny, R. 1986. Einige Notizen zur Gattung Sievekingia Die Gattung Soterosanthus und zwei neue Arten: Sievekingia herrenhuasana und herklotziana. Orchidee (Hamburg) 37(2): 73–80.Jørgensen, P. M. & S. León-Yánez. (eds.) 1999. Catalogue of the vascular plants of Ecuador, Monographs in Systematic Botany from the Missouri Botanical Garden 75: i–viii, 1–1181. Missouri Botanical Garden, St. Louis

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formpseudobulbous epiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max100 m

Elevation min0 m

Epiphyteobligatory

Growth formepiphyte

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Soterosanthus shepheardii has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences4

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSKM458407.1 ↗674 bp

ACGT

GGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAATACACATCGAGCGATTCAGAGAACCCGT …

Soterosanthus shepheardii 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type14 records

Wild obs. + sensor1

Museum / vouchered13

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 2≤10 km 4>10 km 4

10 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pontificia Universidad Javeriana (PUJ)location not on record	8
Saint Louis, US	2
Universidad Nacional de Colombia (UNAL)location not on record	2
Universidad de Antioquia (UdeA)location not on record	1

4 institutions · 13 of 13 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Soterosanthus shepheardii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)