Sorghastrum secundum

(Elliott) Nash · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Sorghastrum

At a glance

Occurrence records948

Data sources11

Biological traits10

DNA specimens2

eDNA detections1

Sources11 archives

Databases and archives Sorghastrum secundum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility948 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF948 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Sorghastrum secundum is a species of grass known by the common name lopsided Indiangrass. It is native to the southeastern United States.Sorghastrum secundum. NatureServe. This species is a perennial bunchgrass growing up to 6 feet tall. The flat leaf blades are up to 24 inches long. The ligule is pointed. The inflorescence is one-sided.Sorghastrum secundum. USDA NRCS Plant Fact Sheet. This plant provides forage for livestock. It grows best on well-drained soils. It is a larval host plant to the pepper-and-salt skipper.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sorghastrum secundum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences7

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ005078.1 ↗576 bp

ACGT

CAAAACAGACCGCGAACGCGTCTCTCGTGCCGCCGGGCTCCGGCCCGGCACAAGGCCCCCGAGCTCCGTCACGGGGCGGAGGGGCCGCAA …

Sorghastrum secundum voucher Columbus 4243 RSA internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Sorghastrum secundum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Garber 1950

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type948 records

Wild obs. + sensor660

Museum / vouchered288

Range

Area of Occupancy AOO2 528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 347≤1 km 90≤10 km 25>10 km 50

512 georeferenced · 148 without coordinates

Open the mapobservation + sensor660

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 9≤1 km 11≤10 km 28>10 km 28

76 georeferenced · 212 without coordinates

Open the institutions mapphysical evidence288

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	73
Jena Microbial Resource Collectionlocation not on record	46
Miami, US	32
Valdosta State Universitylocation not on record	18
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	16
Jackson, US	11
AUAlocation not on record	10
GAlocation not on record	8
BAYLUlocation not on record	8
Bronx, US	6
Tall Timbers Research Stationlocation not on record	6
Saint Louis, US	5
Bloomington, US	5
Wuzhou, CN	4
EL PASO, US	3
Auckland, NZ	3
Tuscaloosa, US	3
Canadian Department of Agriculturelocation not on record	2
University of Stellenboschlocation not on record	2
Tempe, US	2
McWane Science Centerlocation not on record	2
Guasave, MX	1
Chapel Hill, US	1
Columbia, US	1
Stockholm, SE	1
Claremont, US	1
Knoxville, US	1
Logan, US	1
Wlocation not on record	1
Williamsburg, US	1
Chongqing Museumlocation not on record	1
San Angelo, US	1
Pittsburg, US	1
Ciudad de México, MX	1
Due West, US	1
Dekalb, US	1
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	1
Flagstaff, US	1
Chapingo, MX	1
Taipei, TW	1

40 institutions · 284 of 288 vouchered records shown · 4 without an institution code

09Environmental DNA1 detections

Where the DNA of Sorghastrum secundum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)