Sordaria macrospora

Auersw. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Sordariales/Sordariaceae/Sordaria

At a glance

Occurrence records180

Data sources12

Biological traits0

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Sordaria macrospora's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility180 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS42 compounds

Occurrence & distributionGBIF180 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT · NCBI39 Mbp

01Narrative

Sordaria macrospora is a species of coprophilous (dung-colonizing) fungus. It is one of several fungal model organisms in biology, e.g. the model of fruiting body development in Ascomycetes. It is a homothallic, self-fertile organism. Ascospores issued from a diploid heterozygous at the spore-color locus, segregate as yellow and black. Different colors patterns reflect DNA recombination events during meiotic prophase. Lighter colors are due to incomplete maturation.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition42 compounds

Compounds documented for Sordaria macrospora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Dolastane diterpenoids15

Simple aromatic polyketides8

Pachydictyane diterpenoids7

Dolabellane diterpenoids3

Xenicane diterpenoids3

Documented compounds42 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Dolasta-1(15),7,9-trien-14-ol	present	NPASS
(-)-Amijiol	present	NPASS
(-)-Isoamijiol	present	NPASS
(1R,2S,6R,7S,10S)-3,7-dimethyl-10-[(2R)-6-methylhept-5-en-2-yl]-11-oxatricyclo[5.3.1.02,6]undec-3-ene	present	NPASS
(1R,3aR,4E,6S,9E,12S,12aS)-1-(2-hydroxypropan-2-yl)-3a,6,10-trimethyl-2,3,6,7,8,11,12,12a-octahydro-1H-cyclopenta[11]annulen-12-ol	present	NPASS
(1S,2E,5E,9S)-6-methyl-9-[(2R)-6-methylhept-5-en-2-yl]cyclonona-2,5-diene-1,2-dicarbaldehyde	present	NPASS
(3aR,8R,8aS)-2,3,3a,5,6,7,8,8a,9,10-Decahydro-3a,8a-dimethyl-5-methylene-1-(1-methylethyl)benz[f]azulen-8-ol	present	NPASS
(3aS,4R,5S,8S,8aR)-3,8-dimethyl-5-[(2R)-6-methylhept-5-en-2-yl]-3a,4,5,6,7,8a-hexahydro-1H-azulene-4,8-diol	present	NPASS
(3aS,4S,5R,8aS)-5-[(2R)-2-hydroxy-6-methylhept-5-en-2-yl]-3-methyl-8-methylidene-3a,4,5,6,7,8a-hexahydro-1H-azulen-4-ol	present	NPASS
(3R,5aS,6S,9aR,10aS)-5a,10a-dimethyl-9-methylidene-3-propan-2-yl-2,5,6,7,8,10-hexahydro-1H-benzo[f]azulene-3,6,9a-triol	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sordaria macrospora has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections2

Countries8

The DNA barcodea real sequence read deposited for this species

ITSPP574363.1 ↗526 bpChina

ACGT

CCGTAGGTGAACCTGCGGAGGGATCATTACAGAGTTGCAAAACTCCAACAAACCATCGCGAATCTTACCCGTACGGTTGCCTCGGCGCTG …

Sordaria macrospora isolate NX13 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Sordaria macrospora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size38 700 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Sordaria macrospora0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

Completeness98.5% BUSCO

08Occurrence & distribution

Record type180 records

Wild obs. + sensor84

Museum / vouchered94

Cultivated / captive1

Other1

Range

Area of Occupancy AOO568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 14≤1 km 13≤10 km 54>10 km 2

83 georeferenced · 1 without coordinates

Open the mapobservation + sensor84

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 3≤1 km 10≤10 km 40>10 km 13

66 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence94

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uppsala, SE	29
Toronto, CA	21
Bernard Price Institute for Palaeontological Researchlocation not on record	11
Auckland, NZ	7
Tartu, EE	2
SLU Artdatabankenlocation not on record	2
MeiseBGlocation not on record	2
Olocation not on record	1
Museo Entomologico de Leonlocation not on record	1
BDBClocation not on record	1
ER, HKASlocation not on record	1
UAclocation not on record	1
LDlocation not on record	1
FLASlocation not on record	1
Baton Rouge, US	1
Copenhagen, DK	1

16 institutions · 83 of 94 vouchered records shown · 11 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Sordaria macrospora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)