Sorbus scalaris

Koehne · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Sorbus

At a glance

Occurrence records133

Data sources8

Biological traits28

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Sorbus scalaris's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility133 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Occurrence & distributionGBIF133 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 34

01Narrative

Sorbus scalaris is a species of rowan. It is native to western Sichuan and Yunnan in China where it grows in mixed forests on mountain slopes at altitudes of 1600–3000 m. S. scalaris is a shrub or small tree, 3–7 m tall. Sorbus scalaris is sometimes cultivated. It said to be the most attractive small tree among the orange-fruited Rowan species. Because it is self-incompatible and very few clones are cultivated, most seedlings raised from this species by gardeners are hybrids.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology16

Fruit length5.5 mm

Fruit length max6 mm

Fruit length min5 mm

Fruit width5.5 mm

Fruit width max6 mm

Fruit width min5 mm

Inflorescence length max11 cm

Inflorescence length min5 cm

Leaf length25 mm

Leaf length max30 mm

Leaf length min20 mm

Leaf width max14 mm

Leaf width min6 mm

Plant height5 m

Plant height max7 m

Plant height min3 m

Life cycle & reproduction3

Deciduousnessdeciduous

Life formtree

Life spanperennial

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max2 600 m

Elevation mean2 100 m

Elevation min1 600 m

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sorbus scalaris has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLNC_085637.1 ↗160 065 bpChina

ACGT

TATATTTAATATTATTTAATATTAAATTAATTAATATTATGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTG …

Sorbus scalaris isolate LB059 voucher Xiao-Hua JIN et al.#ST2145 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Sorbus scalaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 341×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type133 records

Wild obs. + sensor3

Museum / vouchered130

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 130 records without

Open the institutions mapphysical evidence130

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chengdu, CN	39
Beijing, CN	26
Chengdu, CN	16
Cambridge, US	13
Seoul, KR	8
Kunming, CN	6
Guangzhou, CN	4
Nanjing, CN	4
Guilin, CN	3
Xian, CN	2
Tianjin Natural History Museumlocation not on record	2
Strecker Museum, Baylor Universitylocation not on record	2
Zhejiang Universitylocation not on record	1
Xiamen, CN	1
Chinese Academy of Forestrylocation not on record	1
WNNUlocation not on record	1
South Kensington, GB	1

17 institutions · 130 of 130 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)