Sorbus sargentiana

Koehne · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Sorbus

At a glance

Occurrence records191

Data sources9

Biological traits27

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Sorbus sargentiana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility191 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources27 traits

Occurrence & distributionGBIF191 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 34

01Narrative

Sorbus sargentiana, Sargent's rowan () is a species of flowering plant in the family Rosaceae, native to southwestern Sichuan and northern Yunnan in China, where it grows at altitudes of 2000 -.Rushforth, K. (1999). Trees of Britain and Europe. Collins .

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology15

Fruit length5.5 mm

Fruit length max6 mm

Fruit length min5 mm

Fruit width5.5 mm

Fruit width max6 mm

Fruit width min5 mm

Leaf length100 mm

Leaf length max130 mm

Leaf length min70 mm

Leaf width max42 mm

Leaf width min20 mm

Plant height8 m

Plant height max10 m

Plant height min6 m

Seed mass0.734 mg

Life cycle & reproduction3

Deciduousnessdeciduous

Life formtree

Life spanperennial

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max3 200 m

Elevation mean2 600 m

Elevation min2 000 m

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sorbus sargentiana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOR915977.1 ↗159 250 bpChina

ACGT

ATATTATGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCCCTGTA …

Sorbus sargentiana isolate Z0244 voucher Hong-Gui XU#1532 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Sorbus sargentiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 341×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type191 records

Wild obs. + sensor13

Museum / vouchered174

Cultivated / captive4

Origin

Introduced1

Range

Area of Occupancy AOO180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 3≤1 km 7≤10 km 3

13 georeferenced

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 174 records without

Open the institutions mapphysical evidence174

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy75% within 1 km

≤1 km 3≤10 km 1

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chengdu, CN	51
Beijing, CN	45
Cambridge, US	19
Guangzhou, CN	9
Chengdu, CN	8
Seoul, KR	5
Kunming, CN	5
Xiamen, CN	5
Yangling, CN	3
Xian, CN	3
Guilin, CN	3
Strecker Museum, Baylor Universitylocation not on record	2
“Manash Kozybayev North Kazakhstan University" NPLClocation not on record	2
Jiangxi Agricultural Universitylocation not on record	2
South Kensington, GB	2
Nanjing, CN	2
Davis, US	1
Adam Mickiewicz University in Poznańlocation not on record	1
Chongqing Natural History Museumlocation not on record	1
Central China Normal Universitylocation not on record	1
Zhejiang Universitylocation not on record	1
Wuhan, CN	1
Jiangxi Universitylocation not on record	1
Vancouver, CA	1

24 institutions · 174 of 174 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)