Sorbus sambucifolia

(Cham. & Schltdl.) M.Roem. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Sorbus

At a glance

Occurrence records1 312

Data sources10

Biological traits16

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Sorbus sambucifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 312 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF1 312 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 34

01Narrative

Рябина бузинолистная — вид деревянистых растений рода Рябина (Sorbus) семейства Розовые (Rosaceae), распространённый на западных Алеутских островах, Дальнем Востоке России, полуострове Корея и в Японии.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height3 m

Plant height max2.5 m

Plant height min1 m

Life cycle & reproduction5

Flowering endJul

Flowering startJun

Life formtree

Life spanperennial

Lifespan years10 years

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Habitat GIFTforest, forest edges, mountains, shores

Woodinesswoody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sorbus sambucifolia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences8

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSFJ810048.1 ↗587 bp

ACGT

TCGAACCTGCACAGCAGAACGACCCGAGAACCAGTTTCAACGTCGGGGGTCGGCGGGCCTTCGGGCTCGGCGTCCCCTTATCCCGGGAGC …

Sorbus sambucifolia isolate 5753 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Sorbus sambucifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidy2× diploid · measured

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 341×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Zaikonnikova, T. I. & V. V. Kipiana. 1980. Chromosome numbers of some species of the genus Sorbus (Rosaceae) of the USSR flora. Bot. Zhurn. SSSR 65(9): 1226–1230.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GIFT · GIFT (floras)

GIFT · GIFT (floras)

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 312 records

Wild obs. + sensor856

Museum / vouchered443

Cultivated / captive9

Other4

Range

Area of Occupancy AOO3 492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 288≤1 km 98≤10 km 117>10 km 212

715 georeferenced · 141 without coordinates

Open the mapobservation + sensor856

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 1≤1 km 12≤10 km 98>10 km 11

122 georeferenced · 321 without coordinates

Open the institutions mapphysical evidence443

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	74
Shinshu Universitylocation not on record	69
WTUlocation not on record	50
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	31
Toyama, JP	29
Odawara, JP	28
JP	24
Tomioka, JP	15
Chiba, JP	14
Tsukuba, JP	13
KIRMlocation not on record	13
Nagano City, JP	11
FFPRIlocation not on record	10
Omachi Alpine Museumlocation not on record	8
Burlington, US	6
Obihiro Centennial City Museumlocation not on record	4
Sanda, JP	4
Kushiro City Museumlocation not on record	4
Universidad Católica de Santa Maríalocation not on record	3
IWEP FEB RASlocation not on record	2
Otaru, JP	2
Olocation not on record	2
Frankfurt am Main	2
Institute of the biological problems of the North FEB RASlocation not on record	2
Edinburgh, GB	2
J.F.Oberlin Universitylocation not on record	2
Bronx, US	2
Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record	1
San Diego, US	1
Wellington, NZ	1
Philadelphia, US	1
Kew, GB	1
Stockholm, SE	1
Kyoto Universitylocation not on record	1
Herbarium of the Department of Botany, University of Tokyolocation not on record	1
Vancouver, CA	1
Sendai, JP	1
Davis, US	1

38 institutions · 437 of 443 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Sorbus sambucifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sorbus sambucifolia

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction5

Diet & foraging1

Habitat & environment7

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 312 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions21 of 38 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 312 records