Sorbus randaiensis

(Hayata) Koidz. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Sorbus

At a glance

Occurrence records415

Data sources10

Biological traits26

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Sorbus randaiensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility415 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Occurrence & distributionGBIF415 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 34

01Narrative

Sorbus randaiensis is a deciduous tree of family Rosaceae. It is an endemic species in Taiwan and can be found in the mountain areas of middle Taiwan, with altitude 1,800m to 3,200m, mostly spotted in the forest of Xueshan, Hehuan Mountain, , and Nenggao Mountain. It is a tree 3–8 m tall with white flowers and reddish fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology16

Fruit length5 mm

Fruit length max5 mm

Fruit length min5 mm

Fruit width5 mm

Fruit width max5 mm

Fruit width min5 mm

Leaf length47.5 mm

Leaf length max55 mm

Leaf length min40 mm

Leaf width12.5 mm

Leaf width max15 mm

Leaf width min10 mm

Plant height5.5 m

Plant height max8 m

Plant height min3 m

Seed mass3.84 mg

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max4 160 m

Elevation mean3 130 m

Elevation min2 100 m

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sorbus randaiensis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences8

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKY964728.1 ↗676 bpTaiwan · 2015

ACGT

TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCTGCACAGCAGAACGACCCGAGAACCAGTTTCAACGTCGGGGGTCGGCGGGCCT …

Sorbus randaiensis voucher TNM F0029302 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Sorbus randaiensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 341×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type415 records

Wild obs. + sensor313

Museum / vouchered95

Cultivated / captive6

Other1

Origin

Native5

Range

Area of Occupancy AOO344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 153≤1 km 54≤10 km 11>10 km 6

224 georeferenced · 89 without coordinates

Open the mapobservation + sensor313

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence95

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taipei, TW	27
National Museum of Natural Sciencelocation not on record	23
Taipei, TW	19
Taipei, TW	12
TAIElocation not on record	5
Kew, GB	3
Edinburgh, GB	3
Beijing, CN	1
Saint Louis, US	1
Philadelphia, US	1

10 institutions · 95 of 95 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Sorbus randaiensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)