Sorbus pseudovilmorinii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Sorbus

At a glance

Occurrence records9

Data sources4

Biological traits3

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Sorbus pseudovilmorinii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility9 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF9 records

DNA & barcodingNCBIsequences

01Narrative

Sorbus pseudovilmorinii is a variable deciduous flowering tree.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Life cycle & reproduction1

Life formtree

Habitat & environment1

Climatetemperate

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sorbus pseudovilmorinii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOR915973.1 ↗159 974 bpChina

ACGT

TATTAAGAAAAATAAATACACTTAACACAAAAGCAGAAAAAGAAATAATAGTAACCTGGTCCCGAGCGTCTACCATTTATATTTAATATT …

Sorbus pseudovilmorinii isolate Z0238 voucher D.E.Boufford et al.#37204 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL2

plant barcode

08Occurrence & distribution

Record type9 records

Museum / vouchered3

Other6

Range

Area of Occupancy AOO32 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	2

1 institutions · 2 of 3 vouchered records shown · 1 without an institution code