Sorbus poteriifolia

Hand.-Mazz., Anz.Kaiserl.Akad.Wiss.Wien & Math.-Naturwiss.Kl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Sorbus

At a glance

Occurrence records80

Data sources7

Biological traits28

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Sorbus poteriifolia's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility80 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Occurrence & distributionGBIF80 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 68

01Narrative

Sorbus poteriifolia is a species of rowan native to south-central China and northern Myanmar. It is a shrub found at 3000 to 4000m above sea level. It has gained the Royal Horticultural Society's Award of Garden Merit as an ornamental.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology14

Fruit length7 mm

Fruit length max8 mm

Fruit length min6 mm

Fruit width7 mm

Fruit width max8 mm

Fruit width min6 mm

Leaf length15 mm

Leaf length max20 mm

Leaf length min10 mm

Leaf width max9 mm

Leaf width min6 mm

Plant height1.4 m

Plant height max2.7 m

Plant height min0.1 m

Life cycle & reproduction5

Deciduousnessdeciduous

Flower length max7 mm

Flower length min6 mm

Life formtree

Life spanperennial

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max4 000 m

Elevation mean3 500 m

Elevation min3 000 m

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sorbus poteriifolia has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLNC_085663.1 ↗160 060 bpChina

ACGT

TATATTTAATATTATTTAATATTAAATTAATTAATATTATGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTG …

Sorbus poteriifolia isolate Z0237 voucher Qingzang Team#8804 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Sorbus poteriifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 68 n = 34

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 681×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type80 records

Wild obs. + sensor1

Museum / vouchered72

Cultivated / captive4

Other3

Range

Area of Occupancy AOO148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 72 records without

Open the institutions mapphysical evidence72

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 3 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	20
Kew, GB	10
Edinburgh, GB	10
CASlocation not on record	8
Taipei, TW	8
Cambridge, US	3
Cambridge, US	3
University of Stellenboschlocation not on record	2
Kunming, CN	1
Vancouver, CA	1
Taipei, TW	1
Paris, FR	1
Davis, US	1
Saint Louis, US	1
WNNUlocation not on record	1

15 institutions · 71 of 72 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)