Sorbus microphylla

(Wall. ex Hook.fil.) Wenz. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Sorbus

At a glance

Occurrence records95

Data sources8

Biological traits13

DNA specimens0

eDNA detections1

Sources8 archives

Databases and archives Sorbus microphylla's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility95 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF95 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Sorbus microphylla, the small-leaf rowan, is a species of Sorbus found in the Himalayas and China. It is probably a species aggregate. The berries are eaten by red pandas (Ailurus fulgens).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass4.01 mg

Life cycle & reproduction3

Deciduousnessdeciduous

Life formtree

Life spanperennial

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max4 500 m

Elevation min3 000 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sorbus microphylla has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOR915906.1 ↗159 936 bpChina

ACGT

TATATTTAATATTATTTAATATTAAATTAATTAATATTATGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTG …

Sorbus microphylla isolate LB028 voucher FLPH Sichuan Expedition#151286 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

08Occurrence & distribution

Record type95 records

Wild obs. + sensor15

Museum / vouchered80

Range

Area of Occupancy AOO312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 4

6 georeferenced · 9 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 14>10 km 2

16 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence80

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Herbarium of the Department of Botany, University of Tokyolocation not on record	31
GMBAlocation not on record	15
Kew, GB	13
Kathmandu, NP	5
Beijing, CN	3
University of Stellenboschlocation not on record	3
Bronx, US	2
Moscow State Universitylocation not on record	1
Davis, US	1
Xining, CN	1
National Herbarium and Plant Laboratories, Nepallocation not on record	1
Natural History Museum, Tribhuvan Universitylocation not on record	1

12 institutions · 77 of 80 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Sorbus microphylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 13.4–13.4

Seasonal swing summer↔winter16.0 °C

Max temp (day)15.0 °C

Min temp (night)10.0 °C

Precipitation902 mm/mo

Air humidity73.2 %

Moisture balance797 mm/mo

Vapour deficit409 Pa

Wind speed1.60 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)