Sorbus insignis

(Hook.fil.) Hedl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Sorbus

At a glance

Occurrence records54

Data sources9

Biological traits22

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Sorbus insignis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility54 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF54 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 34

01Narrative

Sorbus insignis is a species of rowan. It is a tree to 10 - tall, rarely a shrub. It is native to SW China (NW Yunnan and E Tibet), NE India (Manipur, Sikkim), Myanmar, and Nepal. The plant is sometimes grown as an ornamental plant in stone gardens, parks and yards.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Fruit length7.5 mm

Fruit length max8 mm

Fruit length min7 mm

Fruit width7.5 mm

Fruit width max8 mm

Fruit width min7 mm

Leaf length40 mm

Leaf length max50 mm

Leaf length min30 mm

Leaf width15 mm

Leaf width max20 mm

Leaf width min10 mm

Life cycle & reproduction2

Life formepiphyte

Life spanperennial

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max3 500 m

Elevation mean3 000 m

Elevation min2 500 m

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sorbus insignis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLNC_051947.1 ↗159 993 bp

ACGT

TATATTTAATATTATTTAATATTAAATTAATTAATATTATGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTG …

Sorbus insignis chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Sorbus insignis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 341×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type54 records

Wild obs. + sensor5

Museum / vouchered46

Cultivated / captive2

Other1

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 4

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 46 records without

Open the institutions mapphysical evidence46

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	19
Taipei, TW	9
Beijing, CN	5
Kew, GB	3
Taipei, TW	2
Edinburgh, GB	2
Bronx, US	1
Vancouver, CA	1
Guilin, CN	1
Davis, US	1
University of Stellenboschlocation not on record	1
Herbarium of the Department of Botany, University of Tokyolocation not on record	1

12 institutions · 46 of 46 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)