Sorbus graeca

Gruppe · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Sorbus

At a glance

Occurrence records41

Data sources5

Biological traits11

DNA specimens2

eDNA detections1

Sources5 archives

Databases and archives Sorbus graeca's data was compiled from.

GBIFGlobal Biodiversity Information Facility41 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF41 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesTRYLEDAGIFT

Size & morphology2

Plant height3 m

Seed mass21.81 mg

Life cycle & reproduction3

Deciduousnessdeciduous

Life spanperennial

Lifespan years23 years

Habitat & environment2

Growth formtree

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density550 mg/cm³

Other traits2

Diaspore typeaggregate fruit (syncarpous)

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sorbus graeca has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences6

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKT345415.1 ↗587 bp

ACGT

TCGAACCTGCACAGCAGAACGACCCGAGAACCGGTTTCAACGTCGGGGGTCGGCGGGCCTTCGGGCTCGGCGTCCCCTTATCCCGGGAGC …

Aria graeca isolate S22 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type41 records

Wild obs. + sensor27

Museum / vouchered13

Cultivated / captive1

Origin

Introduced1

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 7≤1 km 9≤10 km 3>10 km 1

20 georeferenced · 7 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence13

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	6
Oskarshamn, SE	2
GJOlocation not on record	1
Beijing, CN	1
Sevilla, ES	1
Uppsala, SE	1
Wlocation not on record	1

7 institutions · 13 of 13 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Sorbus graeca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)