Sorbus aucuparia
speciesAt a glance
Occurrence records957 111
Data sources16
Biological traits148
DNA specimens58
eDNA detections31
Sources16 archives
Databases and archives Sorbus aucuparia's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility957 109 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics58 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page8 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources148 traits
Chemical compositionFooDB · LOTUS · NPASS5 587 compounds
Occurrence & distributionGBIF · PBDB957 111 records
Environmental DNA1 datasets · 7 countries31 detections
DNA & barcodingBOLD · NCBI58 specimens
Genome at a glanceCCDB · GoaT704 Mbp
Deep timePBDB2 fossils
01Narrative
Le Sorbier des oiseleurs ou Sorbier des oiseaux est une espèce de plantes à fleurs de la famille des Rosaceae. C'est un petit arbre qui peut atteindre les 15 mètres de haut. Il vit principalement en lisière de forêts d'épicéas. Le sorbier est cousin avec le cormier. Ses feuilles sont composées de 17 ou 15 folioles lancéolées doublement dentées reliées au pétiole.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology24
Fruit length8.5 mm
Fruit length max8 mm
Fruit length min6 mm
Fruit width10 mm
⚠ sources differ — AusTraits: 10 mm · GIFT: 8.1 mm
Fruit width max8 mm
Fruit width min6 mm
Leaf length105 mm
⚠ sources differ — AusTraits: 105 mm · GIFT: 40 mm
Leaf length max67 mm
Leaf length min30 mm
Leaf size9 374 mm²
⚠ sources differ — TRY: 9 374 mm² · LEDA: 653 mm² · GIFT: 637 mm²
Leaf width17.5 mm
⚠ sources differ — AusTraits: 17.5 mm · GIFT: 14 mm
Leaf width max18 mm
Leaf width min14 mm
Plant height11 m
⚠ sources differ — GIFT: 11 m · AusTraits: 15 m · LEDA: 12 m · USDA: 12.19 m · TRY: 10 m
Plant height generative3.3 m
Plant height max15 m
Plant height min1 m
Seed length4 mm
Seed mass3.56 mg
⚠ sources differ — TRY: 3.56 mg · LEDA: 4.09 mg · GIFT: 29.78 mg
Seed mass max188 mg
Seed mass min0.66 mg
Seed volume3.4 mm³
Seed volume max3.4 mm³
Seed volume min3.4 mm³
Life cycle & reproduction38
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flower colourwhite
Flower conspicuousYes
Flower length max8 mm
Flower length min6 mm
Flowering endJul
Flowering startJun
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formtree
Life spanperennial
Lifespan categoryModerate
Lifespan years97.05 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Reproduction asexualabsent
Resprout abilityYes
Seed number488
Seed spread rateSlow
Seedling vigorMedium
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment33
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max3 600 m
Elevation mean1 700 m
Elevation min900 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureFine
Fruit colourorange
Fruit fleshinessfleshy
Fruit typepome
⚠ sources differ — AusTraits: pome · GIFT: berry
Growth formtree
Growth form USDASingle Stem
Habitat GIFTcommon birch forests, mostly along river valleys
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesscompound
Leaf retentionNo
Leaf shapelanceolate oblanceolate oblong
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min28 in
Shape and orientationErect
Small grainNo
Woodinesswoody
Physiology & chemistry29
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceLow
Cold stratification requiredYes
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceNone
Frost free days min110 days
Leaf C:N ratio29.96 g/g
Leaf c482 mg/g
Leaf dry-matter content (LDMC)369 mg/g
⚠ sources differ — TRY: 369 mg/g · LEDA: 271 mg/g
Leaf n22.38 mg/g
Leaf p1.84 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min28 in
Protein potentialLow
Salinity toleranceNone
Seed longevity index0
Shade toleranceMedium
Soil pH max7.5 pH
Soil pH min5.5 pH
Specific leaf area (SLA)14.36 mm²/mg
Temperature min-33 °F
Wood density583 mg/cm³
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound125 000 per lb
ToxicityNone
Veneer productNo
Other traits9
Diaspore typegenerative dispersule
Fall conspicuousYes
Fruit seed abundanceHigh
Fruit seed conspicuousYes
Fruit seed persistenceYes
Height at 20yr10.67 m
Planting density max1 200 per acre
Planting density min300 per acre
Shoot orientationerect
03Chemical composition5 587 compounds
Compounds documented for Sorbus aucuparia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingFruits
Compound class profile5 classes
Aminoacids67
Glycerophospholipids57
Monosaccharides33
Cinnamic acids and derivatives33
Purine nucleos(t)ides26
Documented compounds5 587 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Neochlorogenic acid | 27.3 mg/100g | FooDB | |
| Quercetin | 7.4 mg/100 g | FooDB | |
| Hyperin | 2.504 mg/100g | FooDB | |
| Kaempferol | 0 mg/100 g | FooDB | |
| Myricetin | 0 mg/100g | FooDB |
05DNA & barcoding58 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sorbus aucuparia has left across the world's sequence archives.
At a glance
DNA specimens58
Marker genes10
GenBank sequences10
eDNA detections31
Countries7
The DNA barcodea real sequence read deposited for this species
ATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGC …
Sorbus aucuparia isolate L43 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK2★rbcL5★rbcLa★ITS3★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemarker
Organelle genome
Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.
▸ Tap any coloured segment — or a gene chip — to see what it is
Mitochondrion
NC_052880 ↗ · 34 protein · 23 tRNA · 2 rRNA
rps1nad1ccmFnatp9nad5ccmBnad9rpl10rps13nad2matRcox2atp6nad4ccmFcmttBcox1ccmCatp4nad4LrnaseHrps3atp8cox3sdh4rpl5+9
Pick a coloured segment on the ring — or a gene chip — to read what that gene does.
protein-codingrRNAtRNA
06Genome at a glanceCCDB · GoaT
The complete instruction manual Sorbus aucuparia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size704 160 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Sorbus aucuparia0.70 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 34 n = 17
Ploidy2× diploid · measured
Chromosome records30–342n range34median34mode56records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3454×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +17
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · slov-fl — Májovský J. & Uhríková A., 1990a: Karyosystematisches Studium der Gattung Sorbus L. emend. Cr. in der Slowakei I. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 37: 5-14.
CCDB · slov-fl — Baranec T. & Murín A., 2003: Karyological analyses of some Korean woody plants. - Biologia (Bratislava) 58/4: 797-804.
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · brit-fl — Al-Bermani, A.-K.K.A., Al-Shammary, K.I.A., Bailey, J.P., Gornall, R.J. Watsonia 19: 269-271 (1993)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2736
CCDB · fl-europaea — V. Sorsa, 1962
CCDB · poland — Skali?ska M., Ma?ecka J., Izmai?ow R. et al. 1974. Further studies in chromosome numbers of Polish Angiosperms. Tenth contribution. Acta Biol. Cracov. Ser. Bot. 17, 133-163.
CCDB · mediterranean
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — Semerenko, L. V. 1990. Chromosome numbers of some flowering plants from the Berezinsky Biosphere Reservation (the Byelorussian Soviet Socialist Republic). Bot. Žhurn. (Moscow & Leningrad) 75: 279–282.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — Májovský, J. & A. Uhríková. 1990. Karyosystematisches Studium der Gattung Sorbus L. emend. Cr. in der Slowakei I. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 37: 5–15.
CCDB · ipcn-api-dl — Al-Bermani, A. K. K. A., K. I. A. Al-Shammary, R. J. Gornall & J. P. Bailey. 1993. Contribution to a cytological catalogue of the British and Irish flora, 3. Watsonia 19: 169–171.
CCDB · ipcn-api-dl — Goranova, V. 2006. Mediterranean chromosome number reports 16 (1572--1583). Fl. Medit. 16: 425–431.
CCDB · ipcn-api-dl — Petrova, A. 2006. Mediterranean chromosome number reports 16 (1584--1603). Fl. Medit. 16: 431–442.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Baranec, T. & A. Murin. 2003. Karyological analyses of some Korean woody plants. Biologia (Bratislava) 58(4): 797–804.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — GLADKOVA, v. N. 1967. A cytological investigation of Sorbocotoneaster Pojark., a hybridogenous genus of spontaneous origin. (In Russian). Bot. Zhur. 52: 981-983. 440
CCDB · book-ipcn75-78 — Skalinska
CCDB · book-ipcn75-78 — Krogulevich 1978
CCDB · book-ipcn75-78 — Krogulevich 1976
CCDB · book-northern-plants — Liljefors 1934.
CCDB · book-indian_vol1 — Sax, K. 1931a ; Liljefors, A. 1934, 1953 ; T1schler, G. 1934 ; Love, A. 1954b; Love, A. & Love, D. 1956b; Sorsa, V. 1962; Taylor, R.L. & Mulligan, G.A. 1968
CCDB · eflora
CCDB · book-fedorov — Sax K. 1931a
CCDB · book-fedorov — Liljefors 1934, 1953
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — LOve A. 1954b
CCDB · book-fedorov — Love A., Love D. 1956b
CCDB · book-fedorov — Sorsa V. 1962
CCDB · book-atlas-flowering-plants
CCDB · Cave1956supp — Liljefors 1953, 1955
CCDB · CromoCat 2015 — Gabrielan, E. & Zohary, D. (2004). Wild relatives of food crops native to Armenian and Nakhichevan Fl. Medit. 14: 5-80
+10 more references
2n 302×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — López Pacheco, M. J., R. A. Redondo, A. F. Rodríguez, J. I. A. Felpete, C. A. Casado & E. P. Garcia. 2002. Números cromosomáticos de plantas occidentales, 910--920. Anales Jard. Bot. Madrid 59(2): 287.
CCDB · CromoCat 2015 — López Pacheco & al. (2001). Números cromosomáticos de plantas occidentales, 910-920. Anales Jard. Bot. Madrid 59(2): 287.
2n 512×CCDB · Cave1956supp
CCDB · Cave1956supp — Liljefors 1953, 1955
2n 331×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bolstad, A. M. & Salvesen, P. H. (1999). Biosystematic studies of Sorbus meinichii (Rosaceae) at Moster, S. Norway Nordic Journal of Botany 19(5): 547-559
n 172×CCDB · ipcn-api-dl · CCDB · Cave1956supp
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · Cave1956supp — Liljefors 1953, 1955
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time5.33–2.58 Ma
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
Fossil range5.33–2.58 Ma Pliocene
Dated fossil finds2
StatusNot recorded since 2.58 Ma
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Sorbus aucuparia. Above itBeside it, each dot is one dated fossil find — few enough to count, so they are drawn individually rather than as a graph.
fossil range (PBDB)each dot = one dated find
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type957 111 records
Wild obs. + sensor926 501
Museum / vouchered18 872
Cultivated / captive3 955
Fossil26
Other7 757
Origin
Native26 041
Introduced69
Range
Area of Occupancy AOO862 208 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy61% within 1 km
≤100 m 250 424≤1 km 201 159≤10 km 287 375>10 km 3 819
742 777 georeferenced · 183 724 without coordinates
Open the mapobservation + sensor926 501
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy48% within 1 km
≤100 m 1 000≤1 km 6 429≤10 km 7 721>10 km 388
15 538 georeferenced · 3 334 without coordinates
Open the institutions mapphysical evidence18 872
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy7% within 1 km
≤100 m 2≤1 km 1≤10 km 26>10 km 14
43 georeferenced · 3 912 without coordinates
Open the mapnot free-living3 955
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions125 of 234 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 11 974 |
| Moscow State Universitylocation not on record | 412 |
| Salzburg, AT | 411 |
| LDlocation not on record | 328 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 307 |
| BFLlocation not on record | 219 |
| Bergen, NO | 200 |
| Jyväskylä, FI | 182 |
| Olocation not on record | 171 |
| Oulu, FI | 164 |
| Görlitz, DE | 159 |
| MeiseBGlocation not on record | 146 |
| Karlsruhe, DE | 144 |
| Oskarshamn, SE | 122 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 110 |
| Turku, FI | 110 |
| SLU Artdatabankenlocation not on record | 106 |
| Trondheim, NO | 102 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 100 |
| Uniwersytet Warszawskilocation not on record | 99 |
| KMNlocation not on record | 93 |
| Adam Mickiewicz University in Poznańlocation not on record | 88 |
| TROMlocation not on record | 71 |
| Toronto, CA | 67 |
| Garðabær, IS | 64 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 58 |
| WTUlocation not on record | 57 |
| Berlin, DE | 51 |
| Mlocation not on record | 45 |
| Uniwersytet Opolskilocation not on record | 44 |
| Madison, US | 43 |
| Helsinki, FI | 43 |
| Provincia di Livornolocation not on record | 42 |
| MAlocation not on record | 41 |
| TUR-Alocation not on record | 40 |
| Tartu, EE | 39 |
| Entomological Society of Latvialocation not on record | 38 |
| Voronezh State Universitylocation not on record | 36 |
| Wlocation not on record | 34 |
| South Kensington, GB | 34 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 33 |
| Chongqing Museumlocation not on record | 33 |
| Uppsala, SE | 32 |
| Kuopio, FI | 31 |
| 28 | |
| Bloomington, US | 27 |
| GZUlocation not on record | 27 |
| Tallinn, EE | 27 |
| València, ES | 25 |
| Saint John, CA | 25 |
| M-Lichenslocation not on record | 22 |
| Zürich, CH | 22 |
| Bern, CH | 21 |
| Salamanca, ES | 21 |
| UniKSlocation not on record | 21 |
| BClocation not on record | 21 |
| BDBClocation not on record | 20 |
| CICYTEXlocation not on record | 20 |
| Montréal, CA | 20 |
| Acadia Universitylocation not on record | 20 |
| Vitoria, ES | 18 |
| Burlington, US | 18 |
| University of New Hampshirelocation not on record | 17 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 17 |
| Université Lavallocation not on record | 17 |
| St. Paul, US | 16 |
| Christchurch, NZ | 16 |
| Moscow, US | 16 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 15 |
| BRNUlocation not on record | 15 |
| Barcelona, ES | 14 |
| College of the Atlantic, Museumlocation not on record | 14 |
| Kandalaksha State Nature Reservelocation not on record | 13 |
| Frankfurt am Main | 13 |
| Madrid, ES | 13 |
| Green Bay, US | 13 |
| Tula State Universitylocation not on record | 12 |
| ISAlocation not on record | 12 |
| Rovaniemi, FI | 11 |
| Uniwersytet Jagiellońskilocation not on record | 11 |
| Ann Arbor, US | 11 |
| DBF-NHMDlocation not on record | 10 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 10 |
| Pullman, US | 10 |
| Victoria, CA | 10 |
| Corvallis, US | 9 |
| Zürich, CH | 9 |
| Millersville, US | 9 |
| Anchorage, US | 9 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 9 |
| Rotorua, NZ | 8 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 8 |
| Canberra, AU | 8 |
| Philadelphia, US | 8 |
| University of Alberta Museumslocation not on record | 7 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 7 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 7 |
| Auckland, NZ | 7 |
| Wellington, NZ | 7 |
| Portland, US | 7 |
| Bangkok, TH | 7 |
| Universidade de Lisboa, Museu Bocagelocation not on record | 6 |
| Philadelphia, US | 6 |
| SWlocation not on record | 6 |
| Bronx, US | 6 |
| Bourges, FR | 6 |
| Edinburgh, GB | 6 |
| UGentlocation not on record | 6 |
| Porrentruy, CH | 6 |
| Missoula, US | 6 |
| Chicago, US | 6 |
| Natural History Museum Rotterdamlocation not on record | 5 |
| nbflocation not on record | 5 |
| Québec, CA | 5 |
| Denver, US | 5 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 5 |
| College Park, US | 5 |
| BIO-UNIPIlocation not on record | 5 |
| Philadelphia, US | 5 |
| Waverly, US | 5 |
| Museum of the Rockieslocation not on record | 5 |
| Wuzhou, CN | 5 |
| Hobart, AU | 5 |
| Canadian Department of Agriculturelocation not on record | 5 |
| Frauenfeld, CH | 4 |
| Tilburg, NL | 4 |
| Logan, US | 4 |
| Ivano-Frankove, UA | 4 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 4 |
| Museo Entomologico de Leonlocation not on record | 4 |
| Lincoln, US | 4 |
| Boise, US | 4 |
| Pamplona, ES | 4 |
| National Museum Waleslocation not on record | 4 |
| McWane Science Centerlocation not on record | 3 |
| Tromso University Museumlocation not on record | 3 |
| Paris, FR | 3 |
| Museo Achille Folettolocation not on record | 3 |
| Hudson, US | 3 |
| Cheney, US | 3 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 3 |
| Forssa, FI | 3 |
| Tampa, US | 3 |
| Adelaide, AU | 3 |
| Vancouver, CA | 3 |
| Dresden, DE | 3 |
| Granada, ES | 3 |
| SZUlocation not on record | 3 |
| Whitehorse, CA | 3 |
| Durham, US | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Royal Botanic Garden Edinburghlocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Badajoz, ES | 3 |
| BSBIlocation not on record | 3 |
| Davenport, US | 2 |
| Chicago, US | 2 |
| FLADlocation not on record | 2 |
| Xiamen, CN | 2 |
| Dekalb, US | 2 |
| UoB-IBlocation not on record | 2 |
| OLAlocation not on record | 2 |
| GJOlocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Riverside, US | 2 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 2 |
| Glarus, CH | 2 |
| Kew, GB | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| Mount Pleasant, US | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| University of Stellenboschlocation not on record | 2 |
| Smithfield, AU | 2 |
| Santiago de Compostela, ES | 2 |
| Saint Louis, US | 2 |
| CJBGlocation not on record | 2 |
| PRClocation not on record | 2 |
| Parkville, AU | 2 |
| Madrid, ES | 2 |
| Göteborg, SE | 2 |
| Whitewater, US | 2 |
| Pacific Lutheran Universitylocation not on record | 2 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 2 |
| Pamplona, ES | 2 |
| Armidale, AU | 1 |
| Caldwell, US | 1 |
| Staten Island, US | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Mount Annan, AU | 1 |
| Flagstaff, US | 1 |
| Kensington, AU | 1 |
| Sion, CH | 1 |
| Columbia, US | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| Samara National Research Universitylocation not on record | 1 |
| San Sebastián, ES | 1 |
| Fredericksburg, US | 1 |
| TAFORI-LSRClocation not on record | 1 |
| Fulda, DE | 1 |
| EL PASO, US | 1 |
| Coimbra, PT | 1 |
| H-HarzKurtlocation not on record | 1 |
| BGBMlocation not on record | 1 |
| Alcaldía Municipal de Garzón en Huilalocation not on record | 1 |
| University of Wisconsinlocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| Xining, CN | 1 |
| Lausanne, CH | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| J. Rusek Collectionlocation not on record | 1 |
| San Luis Obispo, US | 1 |
| NTNU University Museum, Department of Natural Historylocation not on record | 1 |
| Emporia, US | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Beijing, CN | 1 |
| Chadron, US | 1 |
| Valparaiso, CL | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Claremont, US | 1 |
| China Agricultural Universitylocation not on record | 1 |
| JBCLMlocation not on record | 1 |
| Tampere, FI | 1 |
| Sede dell'Orto botanico del Museo di Storia naturale dell'Università degli Studi di Parmalocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| Bothell, US | 1 |
| BG-NMNHSlocation not on record | 1 |
| Clemson, US | 1 |
| AUT001location not on record | 1 |
| LfUlocation not on record | 1 |
| Pocatello, US | 1 |
| WINlocation not on record | 1 |
234 institutions · 17 895 of 18 872 vouchered records shown · 776 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA31 detections
Where the DNA of Sorbus aucuparia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found31
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 31 detections have coordinates
Open the map7 countries0
Upland woodland regeneration | Riparian
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.6 °C 9.30–15.9
Seasonal swing summer↔winter13.9 °C
Max temp (day)15.7 °C 11.6–18.8
Min temp (night)10.4 °C 5.20–11.8
Precipitation76.6 mm/mo 52.4–101
Air humidity63.1 % 58.0–65.7
Moisture balance-10.7 mm/mo -70.4–61.6
Vapour deficit573 Pa 422–697
Wind speed3.50 m/s 2.80–7.10
Cloud cover51.0 % 42.4–62.7
CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.