Sophronia semicostella

(Hübner, 1813) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Sophronia

At a glance

Occurrence records1 089

Data sources7

Biological traits2

DNA specimens26

eDNA detections26

Sources7 archives

Databases and archives Sophronia semicostella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 089 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 089 records

Environmental DNA2 datasets · 10 countries26 detections

DNA & barcodingBOLD26 specimens

01Narrative

Sophronia semicostella is a moth of the family Gelechiidae. It is found in most of Europe, except Greece, Bulgaria and the islands in the Mediterranean Sea. The wingspan is about 18 mm. Adults are on wing from June to July. The larvae probably feed on Anthoxanthum odoratum.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sophronia semicostella has left across the world's sequence archives.

At a glance

DNA specimens26

BINs2

Marker genes1

eDNA detections26

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

23Gvariable

35Cmostly conserved

40Amostly conserved

85Tmostly conserved

100Tmostly conserved

118Tmostly conserved

133Tmostly conserved

139Cvariable

154Cmostly conserved

157Cvariable

214Amostly conserved

217Gmostly conserved

220Tvariable

235Cmostly conserved

238Cmostly conserved

304Cvariable

319Cmostly conserved

385Tmostly conserved

391Cmostly conserved

401Cmostly conserved

412Amostly conserved

463Cmostly conserved

616Tmostly conserved

625Gvariable

634Cvariable

646Cvariable

AACTTTATATTTTATTTTTGGAGTTTGAGCTGGACTAGTAGGTACTTCTTTAAGATTACTTATTCGAGCAGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes9

BINs2

Most divergent pair4.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sophronia alaicellasame genus8.3%Eutelia cistellatrixsame order9.7%Argyroeides sanguineasame order9.7%Molippa simandensissame order10.2%Lapara phaeobrachyceroussame order10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 089 records

Wild obs. + sensor781

Museum / vouchered290

Other18

Range

Area of Occupancy AOO2 708 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 200≤1 km 212≤10 km 326>10 km 1

739 georeferenced · 42 without coordinates

Open the mapobservation + sensor781

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 110≤1 km 89≤10 km 23

222 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence290

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	62
NHMOlocation not on record	53
Provincia di Livornolocation not on record	40
SLU Artdatabankenlocation not on record	22
Tartu, EE	20
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	12
European Distributed Institute of Taxonomy (EDIT)location not on record	7
Salzburg, AT	6
Stockholm, SE	5
ZSMlocation not on record	4
Tilburg, NL	4
Philadelphia, US	3
Bavarian State Collection of Zoologylocation not on record	3
National Institute of Biological Resourceslocation not on record	2
Durban Natural Science Museumlocation not on record	2
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
South Kensington, GB	2
MZLUlocation not on record	2
University of Kaiserslauternlocation not on record	1
Kuopio, FI	1
Nijmegen, NL	1
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	1
Rovaniemi, FI	1

23 institutions · 256 of 290 vouchered records shown · 34 without an institution code

09Environmental DNA26 detections

Where the DNA of Sophronia semicostella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys2

Countries10

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map10 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 11.6–17.1

Seasonal swing summer↔winter19.5 °C

Max temp (day)19.0 °C 15.5–21.1

Min temp (night)11.5 °C 5.80–14.6

Precipitation82.6 mm/mo 57.5–146

Air humidity59.4 % 57.9–62.2

Moisture balance-36.6 mm/mo -71.7–55.2

Vapour deficit729 Pa 567–800

Wind speed3.10 m/s 2.10–4.90

Cloud cover37.6 % 34.8–43.9

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sophronia semicostella

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type1 089 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 089 records