Sophronia chilonella

(Treitschke, 1833) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Sophronia

At a glance

Occurrence records101

Data sources8

Biological traits0

DNA specimens7

eDNA detections7

Sources8 archives

Databases and archives Sophronia chilonella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility101 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF101 records

Environmental DNA1 datasets · 4 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Sophronia chilonella is a moth of the family Gelechiidae. It was described by Treitschke in 1833. It is found in Spain, France, Italy, Germany, Denmark, Austria, the Czech Republic, Slovakia, Hungary, Poland, Norway, Sweden, the Baltic region, Russia, Ukraine, Belarus and Greece.funet.fiFauna Europaea The wingspan is 11–13 mm. The larvae feed on Artemisia campestris.lepiforum.de

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sophronia chilonella has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections7

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

97Cvariable

211Gmostly conserved

316Gmostly conserved

616Cmostly conserved

625Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGGGCCGGCATAGTTGGTACTTCTTTAAGTTTATTAATCCGAGCTGAATTAGGAAATCCGGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.25%

Haplotypes5

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sophronia humerellasame genus7.3%Sophronia sicariellussame genus8.4%Cyana hamatasame order10.5%Selenia lunulariasame order10.6%Iridopsis gaujonisame order10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type101 records

Wild obs. + sensor19

Museum / vouchered82

Range

Area of Occupancy AOO148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 8≤1 km 9≤10 km 2

19 georeferenced

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 8≤1 km 19≤10 km 39

66 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence82

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	43
Tartu, EE	19
DanishLepidopterologicalSocietylocation not on record	8
NHMOlocation not on record	5
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
NMPClocation not on record	1
ZSMlocation not on record	1

7 institutions · 78 of 82 vouchered records shown · 4 without an institution code

09Environmental DNA7 detections

Where the DNA of Sophronia chilonella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 15.6–19.1

Seasonal swing summer↔winter21.4 °C

Max temp (day)21.0 °C 19.7–23.0

Min temp (night)11.6 °C 10.3–13.1

Precipitation72.1 mm/mo 50.9–85.4

Air humidity57.3 % 55.9–58.1

Moisture balance-51.0 mm/mo -77.6–-47.5

Vapour deficit813 Pa 756–960

Wind speed3.40 m/s 2.40–3.80

Cloud cover35.6 % 33.8–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)