Sophora tonkinensis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Sophora

At a glance

Occurrence records45

Data sources10

Biological traits5

DNA specimens3

eDNA detections4

Sources10 archives

Databases and archives Sophora tonkinensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility45 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources5 traits

Chemical compositionLOTUS · NPASS147 compounds

Occurrence & distributionGBIF45 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Sophora tonkinensis is a herb used in traditional Chinese medicine. Sofalcone is an oral gastrointestinal medication and a synthetic derivative of sophoradin, an isoprenyl chalcone found in S. tonkinensis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height1 m

Life cycle & reproduction1

Life formshrub or tree

Habitat & environment3

Climatesubtropical

Growth formtree

Woodinesswoody

03Chemical composition147 compounds

Compounds documented for Sophora tonkinensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Quinolizidine alkaloids55

Flavanones40

Chalcones13

Oleanane triterpenoids12

Pyridine alkaloids $ Quinolizidine alkaloids12

Documented compounds147 total

Compound	Amount	Source
(+)-12alpha-Hydroxysophocarpine	present	LOTUS
(+)-5alpha-Hydroxyoxymatrine	present	LOTUS
(+)-Maackiain	present	NPASS
(+)-Sophoranol	present	LOTUS
(-)-12beta-Hydroxyoxysophocarpine	present	LOTUS
(-)-12beta-Hydroxysophocarpine	present	LOTUS
(-)-14beta-Hydroxymatrine	present	LOTUS
(-)-14beta-Hydroxyoxymatrine	present	LOTUS
(-)-9alpha-Hydroxysophocarpine	present	LOTUS
(-)-Kurarinone	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sophora tonkinensis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences10

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSON228771.1 ↗614 bp

ACGT

TCGAATCCTCACAAAGCAGTGCGACCCGCGAATTTGTTTGACTACTCGGGTGCGGCTTGGGGTGCATGGCGCCTCGGTCCCCCTAGTGTC …

Sophora tonkinensis var. polyphylla voucher M. Liao & J.Y. Zhang xubo1556 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK3rbcL4ITS3ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type45 records

Museum / vouchered45

Range

Area of Occupancy AOO108 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 45 records without

Open the institutions mapphysical evidence45

10Collections & institutions

Holding institutions6 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guilin, CN	23
Beijing, CN	8
Kunming, CN	4
Guangzhou, CN	4
Saint Louis, US	2
Taipei, TW	1

6 institutions · 42 of 45 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Sophora tonkinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.