Sophora tomentosa
speciesAt a glance
Occurrence records4 283
Data sources14
Biological traits49
DNA specimens19
eDNA detections13
Sources14 archives
Databases and archives Sophora tomentosa's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 283 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics19 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources49 traits
Chemical compositionLOTUS · NPASS110 compounds
Occurrence & distributionGBIF4 283 records
Environmental DNA1 datasets · 3 countries13 detections
DNA & barcodingBOLD · NCBI19 specimens
Genome at a glanceCCDB2n = 18
01Narrative
イソフジは、マメ科クララ属の常緑低木。方言名：ハブュキギー、ハママミ、イカヌタマグ。
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology21
Fruit length130 mm
Fruit length max190 mm
Fruit length min70 mm
Fruit width10 mm
Leaf length44 mm
Leaf length max300 mm
Leaf length min100 mm
Leaf width29 mm
Leaf width max90 mm
Leaf width min10 mm
Petiole length2 cm
Plant height5 m
⚠ sources differ — GIFT: 5 m · AusTraits: 5 m · TRY: 4 m
Plant height max5 m
Plant height min1 m
Seed length7 mm
Seed length max8.5 mm
Seed length min7.5 mm
Seed mass71.43 mg
⚠ sources differ — TRY: 71.43 mg · AusTraits: 130 mg · GIFT: 110 mg
Seed mass max149 mg
Seed mass min71.43 mg
Seed width7 mm
Life cycle & reproduction10
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typewater
Flower colouryellow
Flower length max7 mm
Flower length min5 mm
Flowering timeyyyyyyynnnny
Life formshrub or tree
Life spanperennial
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typelegume_indehiscent
⚠ sources differ — AusTraits: legume_indehiscent · GIFT: pod
Growth formshrub
⚠ sources differ — GIFT: shrub · AusTraits: shrub tree · TRY: Tree, Shrub
Habitat GIFThalophytic vegetation
Leaf compoundnesscompound
Leaf shapeorbicular ovate
Succulenceno
Woodinesswoody
Physiology & chemistry2
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Other traits1
Seeds per fruit1-10
03Chemical composition110 compounds
Compounds documented for Sophora tomentosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols19
Flavanones14
Isoflavanones11
Pyridine alkaloids $ Quinolizidine alkaloids11
Phenanthrenes10
Documented compounds110 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Thermopsine | present | LOTUS | |
| (-)-Maackiain | present | LOTUS | |
| (1R)-1,2,3,4,5,6-Hexahydro-1,5-methano-8H-pyrido(1,2-a)(1,5)diazocin-8-one | present | LOTUS | |
| (1R,9R)-11-methyl-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one | present | LOTUS | |
| (1S,12S,20S)-20-methoxy-5,7,11,19-tetraoxapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13(18),14,16-hexaen-16-ol | present | LOTUS | |
| (1S,5R)-1,2,3,4,5,6-Hexahydro-1,5-methano-8H-pyrido(1,2-a)(1,5)diazocin-8-one | present | LOTUS | |
| (1S,9R)-11-acetyl-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one | present | LOTUS | |
| (1S,9S,10S)-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadeca-2,4-dien-6-one | present | LOTUS | |
| (1S,9S,10S,12S)-12-hydroxy-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadeca-2,4-dien-6-one | present | LOTUS | |
| (2S)-2-(2,4-dihydroxyphenyl)-8-[(2E)-3,7-dimethylocta-2,6-dienyl]-5,7-dihydroxy-2,3-dihydrochromen-4-one | present | LOTUS |
05DNA & barcoding19 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sophora tomentosa has left across the world's sequence archives.
At a glance
DNA specimens19
Marker genes6
GenBank sequences10
eDNA detections13
Countries4
The DNA barcodea real sequence read deposited for this species
AAGTGTTGGGTTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACTAAAGATACTGATATCTTAGCAGC …
Sophora tomentosa TF<JPN>:TW017487 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL9★rbcLa★ITS★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Sophora tomentosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidydiploid inferred
Chromosome records18–182n range18median18mode9records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 189×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · book-indian_vol1 +2
CCDB · ipcn-api-dl — Bernal Gonzalez, M. D. C. & M. P. Martinez/Almeraya. 1989. Determination del cariotipo de algunas especies del genero Sophora L. sens. lat. (familia: Leguminosae).
CCDB · ipcn-api-dl — Kumari, S. & S. S. Bir. 1990. Karyomorphological evolution in Papilionaceae. J. Cytol. Genet. 25: 173–219.
CCDB · ipcn-api-dl — Palomino, G., P. Martínez, C. Bernal & M. S. S. 1993. Diferencias cromosómicas entre algunas especies de los géneros Sophora L. y Styphnolobium Schott. Ann. Missouri Bot. Gard. 80: 284–290.
CCDB · book-ipcn73-74 — FRITSCH, R. 1972. Chromosomenzahlen von Pflanzen der Insel Kuba. II. Kulturpflanze 19: 305-313.
CCDB · book-indian_vol1 — Atchison, E. 1951 ; Pal, M. 1964; Von Reinhard, F. 1972 ; Bir, S.S. & Kumari, S. 1980
CCDB · book-fedorov — Mangenot S., Mangenot G.. 1952, 1962
CCDB · book-fedorov — Atchison 1951
CCDB · book-fedorov — PalM. 1964
CCDB · Cave1959 — Mang. & Mang. 1958
n 92×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn75-78 — Sharma 1970
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type4 283 records
Wild obs. + sensor2 698
Museum / vouchered1 543
Cultivated / captive7
Other35
Origin
Native198
Range
Area of Occupancy AOO7 204 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy91% within 1 km
≤100 m 1 759≤1 km 301≤10 km 109>10 km 89
2 258 georeferenced · 440 without coordinates
Open the mapobservation + sensor2 698
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy48% within 1 km
≤100 m 122≤1 km 39≤10 km 140>10 km 36
337 georeferenced · 1 206 without coordinates
Open the institutions mapphysical evidence1 543
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced · 6 without coordinates
Open the mapnot free-living7
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions85 of 169 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Bronx, US | 74 |
| Saint Louis, US | 67 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 55 |
| Tsukuba, JP | 53 |
| Durango, MX | 46 |
| Mérida, MX | 46 |
| Taipei, TW | 45 |
| Kew, GB | 44 |
| Nishihara, JP | 42 |
| Miami, US | 38 |
| Paris, FR | 38 |
| Blumenau, BR | 35 |
| Salvador, BR | 34 |
| JBRJlocation not on record | 26 |
| Museo Entomologico de Leonlocation not on record | 24 |
| National Museum of Natural Sciencelocation not on record | 24 |
| University of Stellenboschlocation not on record | 22 |
| Ivano-Frankivsk, UA | 17 |
| UFESlocation not on record | 16 |
| Brisbane, AU | 14 |
| Mexico City, MX | 14 |
| Chicago, US | 14 |
| Honolulu, US | 13 |
| Laboratorio de Ictiologialocation not on record | 13 |
| UFBAlocation not on record | 13 |
| Porto Alegre, BR | 13 |
| Taipei, TW | 13 |
| Departamento de Sistematica e Ecologialocation not on record | 12 |
| Austin, US | 11 |
| Beijing, CN | 11 |
| Federal University of Espírito Santolocation not on record | 11 |
| Chaguaramas, TT | 10 |
| Istituto Agrario Castelnuovolocation not on record | 10 |
| Christchurch, NZ | 10 |
| Palmerston, AU | 10 |
| Université de Strasbourglocation not on record | 9 |
| Tapachula, MX | 9 |
| Chengdu, CN | 9 |
| Fort Worth, US | 8 |
| Bloomington, US | 8 |
| Armidale, AU | 8 |
| TAIElocation not on record | 8 |
| Auckland, NZ | 7 |
| South Kensington, GB | 7 |
| UNESClocation not on record | 7 |
| Kagoshima, JP | 7 |
| Criciúma, BR | 7 |
| Moscow State Universitylocation not on record | 7 |
| Guangzhou, CN | 7 |
| LDlocation not on record | 7 |
| INMAlocation not on record | 6 |
| CEPLAClocation not on record | 6 |
| Santa Teresa, BR | 6 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 6 |
| Bangkok, TH | 6 |
| Burlington, US | 6 |
| UNIVILLElocation not on record | 5 |
| Mississippi State, US | 5 |
| MeiseBGlocation not on record | 5 |
| Tampa, US | 5 |
| TNMlocation not on record | 5 |
| Adelaide, AU | 5 |
| UnBlocation not on record | 5 |
| UNICAMPlocation not on record | 5 |
| Mount Annan, AU | 4 |
| Canberra, AU | 4 |
| UFRRJlocation not on record | 4 |
| IPA/SPlocation not on record | 4 |
| Chongqing Museumlocation not on record | 4 |
| Guilin, CN | 4 |
| Universidade Federal do Espírito Santolocation not on record | 4 |
| UFSClocation not on record | 4 |
| Mérida, MX | 4 |
| WAGlocation not on record | 3 |
| BISHlocation not on record | 3 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 3 |
| Nanjing, CN | 3 |
| Wlocation not on record | 3 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 3 |
| Taipei, TW | 3 |
| USP-IBlocation not on record | 3 |
| UNESP-FCAlocation not on record | 3 |
| Zürich, CH | 3 |
| Kunming, CN | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| HUENFlocation not on record | 2 |
| EL PASO, US | 2 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 2 |
| Philadelphia, US | 2 |
| UERJlocation not on record | 2 |
| Brasília, BR | 2 |
| Ann Arbor, US | 2 |
| Stockholm, SE | 2 |
| Forestry and Forest Products Research Institutelocation not on record | 2 |
| UTFPR-SLlocation not on record | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| Hobart, AU | 2 |
| Jena Microbial Resource Collectionlocation not on record | 2 |
| Altos de Pipe, VE | 2 |
| Cruz das Almas, BR | 2 |
| San Francisco de Campeche, MX | 2 |
| Guangzhou, CN | 2 |
| Plocation not on record | 2 |
| BAYLUlocation not on record | 2 |
| Smithfield, AU | 2 |
| Rotorua, NZ | 2 |
| Xiamen, CN | 2 |
| Buffelskloof Private Nature Reserve, Herbariumlocation not on record | 2 |
| Changsha, CN | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Llocation not on record | 1 |
| Millersville, US | 1 |
| Clemson, US | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Mexico City, MX | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Tuscaloosa, US | 1 |
| Cambridge University Herbariumlocation not on record | 1 |
| Seychelles National Herbariumlocation not on record | 1 |
| Mexico City, MX | 1 |
| Chapingo, MX | 1 |
| CPATSAlocation not on record | 1 |
| San Diego, US | 1 |
| Londrina, BR | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 1 |
| National Biodiversity Institute, Costa Ricalocation not on record | 1 |
| Maringá, BR | 1 |
| Montréal, CA | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Foz do Iguaçu, BR | 1 |
| Bogotá, D.C., CO | 1 |
| UFMSlocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| Universidade da Região de Joinville - Univillelocation not on record | 1 |
| Berlin, DE | 1 |
| Campo Mourão, BR | 1 |
| Durham, US | 1 |
| University of Oxfordlocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Seropédica, BR | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| PUC-RSlocation not on record | 1 |
| Riverside, US | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| Austin, US | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| ASUlocation not on record | 1 |
| Göteborg, SE | 1 |
| Budapest, HU | 1 |
| UFMGlocation not on record | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| VALElocation not on record | 1 |
| UEMlocation not on record | 1 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 1 |
| Cibinong, ID | 1 |
| Botanical Garden "Anastasie Fatu" of Iasilocation not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Gump Stationlocation not on record | 1 |
| St. Augustine, TT | 1 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 1 |
| UCAMlocation not on record | 1 |
| Uppsala, SE | 1 |
| UTFPR-DVlocation not on record | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 1 |
| IAPlocation not on record | 1 |
| Cenargenlocation not on record | 1 |
| UFPRlocation not on record | 1 |
169 institutions · 1 306 of 1 543 vouchered records shown · 237 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA13 detections
Where the DNA of Sophora tomentosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found13
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 13 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.9 °C 22.7–25.2
Seasonal swing summer↔winter9.00 °C
Max temp (day)26.5 °C 24.9–28.4
Min temp (night)22.8 °C 18.6–24.7
Precipitation81.5 mm/mo 11.5–172
Air humidity61.9 % 51.9–70.0
Moisture balance-44.0 mm/mo
Vapour deficit1,138 Pa 967–1,376
Wind speed4.70 m/s
Cloud cover37.6 % 20.2–62.6
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.