Sophora molloyi

Heenan & de Lange · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Sophora

At a glance

Occurrence records226

Data sources6

Biological traits2

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Sophora molloyi's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility226 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF226 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Sophora molloyi, the Cook Strait kōwhai, Molloy's kōwhai or Stephen's Island kōwhai, is one of 8 species of kōwhai native to New Zealand, and grows naturally around the Cook Strait region. It was first described as a species in 2001 and named after Brian Molloy of Landcare Research, who was a researcher and scientist there for more than 30 years.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formshrub or tree

Habitat & environment1

Climatesubtropical

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sophora molloyi has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

The DNA barcodea real sequence read deposited for this species

ITSAY056076.1 ↗619 bp

ACGT

TCGAATCCTCACAAAGCAGTGCGACCCGTGAATTTGTTTGACTCCTCGGGTGTGGCTTGAGGTGCATGGCGCCTCGGTCCCCCTAGTGTT …

Sophora molloyi internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Sophora molloyi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · new-zealand · CCDB · ipcn-api-dl

CCDB · new-zealand

CCDB · ipcn-api-dl — de Lange, P. J. & B. G. Murray. 2002. Contributions to a chromosome atlas of the New Zealand flora---37. Miscellaneous families. New Zealand J. Bot. 40: 1–23.

08Occurrence & distribution

Record type226 records

Wild obs. + sensor144

Museum / vouchered82

Origin

Native1

Range

Area of Occupancy AOO280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 79≤1 km 29≤10 km 10>10 km 6

124 georeferenced · 20 without coordinates

Open the mapobservation + sensor144

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 81 without coordinates

Open the institutions mapphysical evidence82

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	40
Wellington, NZ	26
Auckland, NZ	10
Mount Annan, AU	1
Kew, GB	1
Rotorua, NZ	1
Honolulu, US	1
BISHlocation not on record	1
Palmerston North, NZ	1

9 institutions · 82 of 82 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)