Sophora microphylla

Aiton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Sophora

At a glance

Occurrence records3 840

Data sources11

Biological traits37

DNA specimens5

eDNA detections5

Sources11 archives

Databases and archives Sophora microphylla's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 840 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources37 traits

Chemical compositionLOTUS · NPASS19 compounds

Occurrence & distributionGBIF3 840 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 18

01Narrative

صفيراء صغيرة الأوراق هي نوع نباتي يتبع جنس الصفيراء من فصيلة البقولية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Leaf length max150 mm

Leaf width14 mm

Leaf width max14 mm

Leaf width min14 mm

Plant height9.5 m

Plant height max10 m

Seed length7 mm

Seed length max7 mm

Seed length min7 mm

Seed mass72.72 mg

Seed mass max111 mg

Seed mass min58 mg

Life cycle & reproduction7

Deciduousnessevergreen

Dispersal typewater

Life formshrub or tree

Life spanperennial

Pollination modebiotic

Pollination syndromebird

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max100 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Habitat GIFTLowland

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry7

Leaf C:N ratio13.17 g/g

Leaf c507 mg/g

Leaf dry-matter content (LDMC)312 mg/g

Leaf n38.54 mg/g

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)20.86 mm²/mg

03Chemical composition19 compounds

Compounds documented for Sophora microphylla across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones5

Pyridine alkaloids $ Quinolizidine alkaloids4

Isoflavanones3

Quinolizidine alkaloids2

Cinnamic acids and derivatives1

Documented compounds19 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Maackiain	present	LOTUS
(1R)-3-(3-Butenyl)-1,2,3,4,5,6-hexahydro-1,5-methano-8H-pyrido[1,2-a][1,4]diazocin-8-one	present	LOTUS
(1R,9R)-11-methyl-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one	present	LOTUS
(1S,5S)-1,2,3,4,5,6-hexahydro-8H-1,5-methanopyrido[1,2-a][1,5]diazocin-8-one	present	LOTUS
(3R)-5,7-dihydroxy-3-[4-hydroxy-2-methoxy-3-(3-methylbut-2-enyl)phenyl]-6-(3-methylbut-2-enyl)-2,3-dihydrochromen-4-one	present	LOTUS
(3R)-5,7-dihydroxy-3-[4-hydroxy-2-methoxy-3-(3-methylbut-2-enyl)phenyl]-8-(3-methylbut-2-enyl)-2,3-dihydrochromen-4-one	present	LOTUS
(3S)-3,5,7-trihydroxy-3-(5-methoxy-2,2-dimethylchromen-6-yl)-8-(3-methylbut-2-enyl)-2H-chromen-4-one	present	LOTUS
1,5-Methano-8H-pyrido[1,2-a][1,5]diazocin-8-one, 3-(3-butenyl)-1,2,3,4,5,6-hexahydro-, (1R)-	present	LOTUS
2-(3,4-dihydroxyphenyl)-7-[(2S,3R,4S,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	LOTUS
2-(3,4-dihydroxyphenyl)-7-hydroxy-6-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-8-[(2S,3S,4R,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]chromen-4-one	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sophora microphylla has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSON228749.1 ↗614 bp

ACGT

GTCGATCCTCACAAAGCAGTGCGACCCGTGAATTTGTTTGACTCCTCGGGTGTGGCTTGAGGTGCATGGCGCCTCGGTCCCCCTAGTGTT …

Sophora microphylla voucher E.M. Chapman CHR 259574 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL5★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Sophora microphylla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode13records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1813×CCDB · new-zealand · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +2

CCDB · new-zealand

CCDB · ipcn-api-dl — Yeh, M. S., H. YUASA & F. Maekawa. 1986. Chromosome numbers in the Leguminosae. Sci. Rep. Res. Inst. Evol. Biol. 3: 57–71.

CCDB · ipcn-api-dl — Stiefkens, L. B., G. Bernardello & G. J. Anderson. 2003. The karyotype of Sophora tetraptera (Fabaceae). New Zealand J. Bot. 41: 731–735.

CCDB · book-ipcn66 — Hair & Beuzenberg 1966

CCDB · book-fedorov — Atchison 1949a

CCDB · book-fedorov — Rattenbury 1957

CCDB · book-fedorov — Hair, Beuzenberg 1966

CCDB · Cave1958 — Rattenbury 1957

n 93×CCDB · book-ipcn66

CCDB · book-ipcn66 — Hair & Beuzenberg 1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 840 records

Wild obs. + sensor2 479

Museum / vouchered1 346

Cultivated / captive15

Origin

Introduced2

Range

Area of Occupancy AOO7 568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 1 565≤1 km 240≤10 km 60>10 km 41

1 906 georeferenced · 573 without coordinates

Open the mapobservation + sensor2 479

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 14≤1 km 14≤10 km 16>10 km 4

48 georeferenced · 1 298 without coordinates

Open the institutions mapphysical evidence1 346

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 13 without coordinates

Open the mapnot free-living15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	591
Wellington, NZ	286
Auckland, NZ	168
Rotorua, NZ	21
Palmerston North, NZ	21
Valparaiso, CL	11
Museo Entomologico de Leonlocation not on record	10
Hobart, AU	7
Chicago, US	5
LDlocation not on record	5
ASUlocation not on record	4
MAlocation not on record	3
Honolulu, US	3
MeiseBGlocation not on record	3
Saint Louis, US	3
South Kensington, GB	3
Kew, GB	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Armidale, AU	2
Moscow State Universitylocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Riverside, US	1
Dresden, DE	1
València, ES	1
CICYTEXlocation not on record	1
Universität Tübingenlocation not on record	1
San Francisco, US	1

27 institutions · 1 158 of 1 346 vouchered records shown · 185 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Sophora microphylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.70 °C 5.70–8.20

Seasonal swing summer↔winter12.3 °C

Max temp (day)9.20 °C 9.20–13.1

Min temp (night)1.40 °C 1.40–4.30

Precipitation130 mm/mo 130–347

Air humidity62.6 %

Moisture balance54.3 mm/mo 54.3–298

Vapour deficit357 Pa 357–412

Wind speed5.90 m/s 3.10–5.90

Cloud cover38.9 % 33.2–38.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sophora microphylla

At a glance

Sources11 archives

Size & morphology12

Life cycle & reproduction7

Diet & foraging1

Habitat & environment10

Physiology & chemistry7

Compound class profile5 classes

Documented compounds19 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 840 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 27 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 840 records