Sophora howinsula

(W.R.B.Oliv.) P.S.Green · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Sophora

At a glance

Occurrence records143

Data sources6

Biological traits33

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Sophora howinsula's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility143 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF143 records

DNA & barcodingNCBIsequences

01Narrative

Sophora howinsula, commonly known as lignum vitae or Lord Howe kowhai, is a flowering plant in the legume family. The specific epithet refers to the island to which the species is endemic.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology14

Fruit length95 mm

Fruit width14 mm

Leaf length37.5 mm

Leaf length max100 mm

Leaf length min50 mm

Leaf width8 mm

Leaf width max10 mm

Leaf width min6 mm

Petiole length1.15 cm

Plant height13 m

Plant height max15 m

Plant height min3 m

Seed length7 mm

Seed mass78.73 mg

Life cycle & reproduction7

Deciduousnessevergreen

Dehiscencedehiscent

Flowering endSep

Flowering startJul

Life formshrub or tree

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Leaf compoundnesscompound

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sophora howinsula has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences7

The DNA barcodea real sequence read deposited for this species

ITSON228741.1 ↗614 bp

ACGT

TCGGATCCTCACAAAGCAGTGCGACCCGTGAATTTGTTTGACTCCTCGGGTGTGGCTTGAGGTGCATGGCGCCTCGGTCCCCCTAGTGTT …

Sophora howinsula voucher CHR 513353 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type143 records

Wild obs. + sensor55

Museum / vouchered87

Cultivated / captive1

Origin

Native22

Introduced3

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 45≤1 km 7>10 km 1

53 georeferenced · 2 without coordinates

Open the mapobservation + sensor55

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 5≤1 km 24≤10 km 25>10 km 3

57 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence87

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	24
Canberra, AU	16
Museo Entomologico de Leonlocation not on record	13
Christchurch, NZ	8
Parkville, AU	7
Kew, GB	5
Brisbane, AU	3
Auckland, NZ	3
Armidale, AU	2
Hobart, AU	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Wellington, NZ	1

12 institutions · 84 of 87 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)