Sophora chrysophylla

(Salisb.) Seem. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Sophora

At a glance

Occurrence records1 140

Data sources14

Biological traits108

DNA specimens2

eDNA detections2

Sources14 archives

Databases and archives Sophora chrysophylla's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 140 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources108 traits

Chemical compositionLOTUS · NPASS51 compounds

Occurrence & distributionGBIF1 140 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GIFT2n = 16

01Narrative

Sophora chrysophylla, known as māmane in Hawaiian, is a species of flowering plant in the pea and bean family, Fabaceae, that is endemic to Hawaii. It is highly polymorphic, growing as a shrub or tree, and able to reach a height of 15 m in tree form. Yellow flowers are produced in winter and spring.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology13

Fruit length max160 mm

Fruit length min20 mm

Fruit width max7 mm

Fruit width min1 mm

Leaf length max50 mm

Leaf length min7 mm

Leaf width max23 mm

Leaf width min3 mm

Plant height11 m

⚠ sources differ — GIFT: 11 m · USDA: 12.19 m · TRY: 12.19 m

Plant height max15 m

Seed length max8 mm

Seed length min4 mm

Seed mass43.04 mg

⚠ sources differ — TRY: 43.04 mg · GIFT: 40.05 mg

Life cycle & reproduction25

Bloom periodWinter

Coppice potentialNo

Deciduousnessevergreen

⚠ sources differ — TRY: E · GIFT: deciduous

Dehiscencedehiscent

Flower colouryellow

Flower conspicuousYes

Fruit seed period beginSpring

Fruit seed period endSummer

Growth rate USDAModerate

Life formshrub or tree

Life spanperennial

Lifespan categoryLong

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityYes

Seed spread rateModerate

Seedling vigorMedium

Vegetative spread rateNone

Habitat & environment25

Active growth periodYear Round

Adapted to coarse textured soilsYes

Adapted to fine textured soilsYes

Adapted to medium textured soilsYes

BloatNone

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Foliage colorGray-Green

Foliage porosity summerModerate

Foliage porosity winterModerate

Foliage textureMedium

Fruit colouryellow

Fruit typelegume

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Tree, Shrub

Growth form USDASingle Stem

Hedge toleranceMedium

Known allelopathNo

Leaf retentionYes

Low growing grassNo

Mycorrhiza typenon-ectomycorrhizal

Root depth min24 in

Shape and orientationErect

Small grainNo

Woodinesswoody

Physiology & chemistry23

Anaerobic toleranceNone

C:N ratioLow

Caco3 toleranceMedium

Cold stratification requiredNo

Drought toleranceMedium

Fertility requirementMedium

Fire resistantNo

Fire toleranceMedium

Frost free days min350 days

Leaf n29.27 mg/g

Leaf p1.5 mg/g

Moisture useMedium

Nitrogen fixation levelMedium

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Precipitation max150 in

Precipitation min40 in

Salinity toleranceNone

Shade toleranceMedium

Soil pH max7.5 pH

Soil pH min5.5 pH

Specific leaf area (SLA)8.71 mm²/mg

Temperature min24 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityRoutinely Available

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productYes

Palatable browse animalHigh

Palatable graze animalHigh

Palatable humanNo

Post productYes

Pulpwood productNo

Seeds per pound11 325 per lb

ToxicityNone

Veneer productNo

Other traits7

Fall conspicuousNo

Fruit seed abundanceHigh

Fruit seed conspicuousYes

Fruit seed persistenceYes

Height at 20yr12.19 m

Planting density max1 600 per acre

Planting density min400 per acre

03Chemical composition51 compounds

Compounds documented for Sophora chrysophylla across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Pyridine alkaloids $ Quinolizidine alkaloids13

Quinolizidine alkaloids13

Isoflavanones7

Piperidine alkaloids $ Quinolizidine alkaloids6

Pterocarpan3

Documented compounds51 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Echinoisoflavanone	present	LOTUS
(+)-Lupanine	present	LOTUS
(-)-Maackiain	present	LOTUS
(1R)-3-(3-Butenyl)-1,2,3,4,5,6-hexahydro-1,5-methano-8H-pyrido[1,2-a][1,4]diazocin-8-one	present	LOTUS
(1R,2R,9R,10R)-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadecan-6-one	present	LOTUS
(1R,2R,9S,10R)-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadecan-6-one	present	LOTUS
(1R,5S)-3-(3-Buten-1-yl)-1,2,3,4,5,6-hexahydro-1,5-methano-8H-pyrido(1,2-a)(1,5)diazocin-8-one	present	LOTUS
(1R,9R)-11-methyl-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one	present	LOTUS
(1R,9R,10R)-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadec-2-en-6-one	present	LOTUS
(1R,9R,10S)-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadec-2-en-6-one	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sophora chrysophylla has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSON228726.1 ↗614 bp

ACGT

GTCGATCCTCACAAAGCAGTGCGACCTGTGAATTTGTTTGACTCCTCGGGTGGGGCTTGAGGTGCATGGCGCCTCGGTCCCCCTAGTGTT …

Sophora chrysophylla voucher S.J. Carlquist 2064 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB · GIFT

The complete instruction manual Sophora chrysophylla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · Cave1956supp · GIFT · GIFT (floras)

CCDB · Cave1956supp — Skottsberg 1955

GIFT · GIFT (floras)

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 140 records

Wild obs. + sensor945

Museum / vouchered195

Range

Area of Occupancy AOO976 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 519≤1 km 109≤10 km 63>10 km 88

779 georeferenced · 166 without coordinates

Open the mapobservation + sensor945

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 5≤1 km 39≤10 km 14>10 km 2

60 georeferenced · 135 without coordinates

Open the institutions mapphysical evidence195

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BISHlocation not on record	81
Honolulu, US	38
Vancouver, CA	8
Claremont, US	4
Auckland, NZ	3
University of Stellenboschlocation not on record	3
LDlocation not on record	3
Bronx, US	2
Denver, US	1
Flagstaff, US	1
Hudson, US	1
Paris, FR	1
Saint Louis, US	1
San Diego, US	1
Fort Worth, US	1
Chongqing Museumlocation not on record	1

16 institutions · 150 of 195 vouchered records shown · 45 without an institution code

09Environmental DNA2 detections

Where the DNA of Sophora chrysophylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sophora chrysophylla

At a glance

Sources14 archives

Size & morphology13

Life cycle & reproduction25

Habitat & environment25

Physiology & chemistry23

Uses & economy15

Other traits7

Compound class profile5 classes

Documented compounds51 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 140 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 140 records