Sophora cassioides

(F.Phil.) Sparre · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Sophora

At a glance

Occurrence records398

Data sources10

Biological traits12

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Sophora cassioides's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility398 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF398 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaT787 Mbp

01Narrative

Sophora cassioides is a legume tree native to Chile.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass66.23 mg

Life cycle & reproduction2

Life formshrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max900 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sophora cassioides has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes4

GenBank sequences6

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAY616507.1 ↗218 bp

ACGT

ATCGTTGCCCCAATGCCTCAGCCCTGTTGCTAGGCTTAGTAAAGGGGTGAATGTTGGCTTCCCGTGAGCGATGCCTCACGGTTGGCTGAA …

Sophora cassioides voucher Ruiz 391 (CONC) internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Sophora cassioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size787 290 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sophora cassioides0.79 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× diploid · measured

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type398 records

Wild obs. + sensor353

Museum / vouchered45

Range

Area of Occupancy AOO928 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 218≤1 km 57≤10 km 16>10 km 6

297 georeferenced · 56 without coordinates

Open the mapobservation + sensor353

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence45

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	21
Edinburgh, GB	8
Auckland, NZ	5
Wellington, NZ	4
Rotorua, NZ	2
Herbario Universidad de Concepciónlocation not on record	1
Stockholm, SE	1
AASlocation not on record	1
MAlocation not on record	1
Museo Achille Folettolocation not on record	1

10 institutions · 45 of 45 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Sophora cassioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)