Sooglossus thomasseti

(Boulenger, 1909) · species

image placeholder — illustration coming later

Animalia/Chordata/Amphibia/Anura/Sooglossidae/Sooglossus

At a glance

Occurrence records4

Data sources9

Biological traits4

DNA specimens14

eDNA detections4

Sources9 archives

Databases and archives Sooglossus thomasseti's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Amphibian Species of the WorldAMNHamphibian catalog↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF4 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD14 specimens

Genome at a glanceGoaT2n = 26

01Narrative

Thomasset's Seychelles frog or Thomasset's frog (Sooglossus thomasseti) is a species of frog in the family Sooglossidae. It is endemic to Seychelles. There are two known populations: one on Silhouette Island and one on Mahé Island. The natural habitats of this frog are subtropical or tropical moist lowland forests, subtropical or tropical moist montane forests, rivers, and intermittent rivers. Eggs are laid among rocks and hatch into miniature adults, bypassing a larval stage. The species is threatened by habitat loss. Genetic analysis indicates that the two populations of this species are distinct from each other and are possibly even separate species. It has thus been proposed that both populations be considered evolutionary significant units for conservation purposes. This frog, the rarest in Seychelles, was named for its discoverer, Hans Paul Thomasset (1862-1949).Mathiot, Tony. “The District Of Cascade: A Historical Perspective”, Seychelles Ministry for Youth, Sports & Culture. Retrieved 24 Jun 2022.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmphiBIO

Size & morphology1

SVL4.5 cm

Life cycle & reproduction1

Reproductive output1 /year

Habitat & environment1

Habitat terrestrialyes

Other traits1

Repro directyes

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sooglossus thomasseti has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes11

eDNA detections4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 000 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.07%

Haplotypes2

BIN1

Most divergent pair0.10%

Where individuals differ — all 1 variable positions, in barcode order

843Cvariable

GTGATAATCACCCGTTGAGTGCTTTCAACTAACCATAAAGACATCGGCACCCTGTATTTAATCTTCGGGGCCTGGGCAGGAATAATCGGG …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_020001 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Sooglossus thomasseti carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Chromosome records26–262n range26median26mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 262×GoaT · Animal Chromosome Counts Database · GoaT · Amphibian Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Amphibian Karyotype Database — ↗

07Deep time~15.3 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin15.3 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type4 records

Wild obs. + sensor4

Range

Area of Occupancy AOO16 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 4

4 georeferenced

Open the mapobservation + sensor4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA4 detections

Where the DNA of Sooglossus thomasseti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)