Sonneratia griffithii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Lythraceae/Sonneratia

At a glance

Occurrence records8

Data sources7

Biological traits9

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Sonneratia griffithii's data was compiled from.

GBIFGlobal Biodiversity Information Facility8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF8 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max20 m

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment4

Aquaticsemiaquatic

Climatewet tropical

Growth formtree

⚠ sources differ — GIFT: tree · TRY: hydrohalophyte

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density689 mg/cm³

03Chemical composition2 compounds

Compounds documented for Sonneratia griffithii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Gallotannins2

Documented compounds2 total

Compound	Class	Amount	Source
3-Methylellagic acid		present	LOTUS
Ellagic acid		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sonneratia griffithii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ274734.1 ↗323 bp

ACGT

CAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGGCCCTTTCGGCCGAGGGCACGCCTGCCTGGGTGTCACGCAAC …

Sonneratia griffithii isolate Rn_Sg1 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK7ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type8 records

Museum / vouchered7

Other1

Range

Area of Occupancy AOO24 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 1>10 km 3

4 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence7

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durham, US	3
Kew, GB	1
Kagoshima, JP	1
University of Stellenboschlocation not on record	1

4 institutions · 6 of 7 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Sonneratia griffithii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.