Sonneratia caseolaris

(L.) Engl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Lythraceae/Sonneratia

At a glance

Occurrence records862

Data sources15

Biological traits33

DNA specimens15

eDNA detections7

Sources15 archives

Databases and archives Sonneratia caseolaris's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility804 records↗

OBISOcean Biodiversity Information System58 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Chemical compositionLOTUS · NPASS244 compounds

Occurrence & distributionGBIF · OBIS862 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI15 specimens

Genome at a glanceCCDB · GoaT · NCBI258 Mbp

01Narrative

Sonneratia caseolaris, commonly known as mangrove apple, is a species of plant in the family Lythraceae. The fruit is noted for its outward similarity to the persimmon fruit. Sonneratia caseolaris in Kerala This tree is a type of mangrove growing up to 20 m in height and with a trunk reaching a maximum diameter of 50 cm. It is present in tropical tidal mud flats from Africa to Indonesia, southwards down to northeast Australia and New Caledonia and northwards up to Hainan Island in China and the Philippines. The fruit of this tree is the subject of a legend of Maldivian folklore, Kulhlhavah Falhu Rani. Kuhlhavah (ކުއްޅަވައް) is the Dhivehi name for the mangrove apple (Sonneratia caseolaris). Romero-Frias, Xavier (2012) Folk tales of the Maldives, NIAS Press, , The tree is associated with congregating fireflies throughout southeast Asia and is the food source of moth and other insects.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology9

Fruit length30 mm

Fruit width30 mm

Leaf length45 mm

Leaf width47.5 mm

Petiole length0.55 cm

Plant height17.5 m

⚠ sources differ — GIFT: 17.5 m · AusTraits: 20 m · TRY: 6 m

Plant height max15 m

Seed length11 mm

Seed width5.5 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typewater

Flowering timennnnyyyynnnn

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndrome detailedbat

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formtree

Habitat GIFThalophytic vegetation

Leaf compoundnesssimple

Leaf shapeelliptical oblong widely_elliptical

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density390 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition244 compounds

Compounds documented for Sonneratia caseolaris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Abietane diterpenoids42

Labdane diterpenoids19

Labdane diterpenoids $ Norlabdane diterpenoids18

Eudesmane sesquiterpenoids18

Flavones16

Documented compounds244 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-1(10),4-Cadinadiene	present	NPASS
(+)-alpha-Pinene	present	NPASS
(+)-Copalol	present	NPASS
(+)-Delta-cadinol	present	NPASS
(+)-gamma-Eudesmol	present	NPASS
(+)-Isocupressic acid	present	NPASS
(+)-Isomenthone	present	NPASS
(+)-taxifolin	present	NPASS
(+)-Totarol	present	NPASS
(-)-Hinokiresinol	present	NPASS

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sonneratia caseolaris has left across the world's sequence archives.

At a glance

DNA specimens15

Marker genes5

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLON454074.1 ↗568 bpSri Lanka · 2021

ACGT

CAGAGACTAAAGCAAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAACTGACTTATTATACTCCTGAATATCAAACCAAAGATACTG …

Sonneratia caseolaris isolate R3 ribulose 1,5 biphosphate carboxylose/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★matK-like★rbcL9★ITS★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Sonneratia caseolaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size258 471 428 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sonneratia caseolaris0.26 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–242n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Chen, Z. y., X. x. Huang & Y. z. Gao. 1994. Chromosome counts in genus Sonneratia (Sonneratiaceae). Acta Bot. Austro Sin. 9: 60–62.

CCDB · ipcn-api-dl — Wang, R. j., Z. y. Chen & X. x. Huang. 1998. Chromosome counts on Chinese mangroves. J. Trop. & Subtrop. Bot. 6(1): 40–46.

2n 241×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Graham, S. A., K. Oginuma, P. H. Raven & H. Tobe. 1993. Chromosome numbers in Sonneratia and Duabanga (Lythraceae s.l.) and their systematic significance. Taxon 42: 35–41.

n 111×CCDB · book-ipcn66

CCDB · book-ipcn66 — Muller & Hon-Liu 1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness95.9% BUSCO

08Occurrence & distribution

Record type862 records

Wild obs. + sensor507

Museum / vouchered316

Other39

Origin

Native9

Range

Area of Occupancy AOO1 832 km²

Depth

0–200 m sunlit30

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0 m · max 5 m · 30 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 193≤1 km 81≤10 km 47>10 km 31

352 georeferenced · 155 without coordinates

Open the mapobservation + sensor507

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 3≤1 km 3≤10 km 45>10 km 2

53 georeferenced · 263 without coordinates

Open the institutions mapphysical evidence316

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	36
中国林业科学研究院热带林业科学研究所植物标本室location not on record	15
Smithfield, AU	12
Paris, FR	9
Mount Annan, AU	9
Kew, GB	6
Canberra, AU	5
Bronx, US	5
Honolulu, US	4
Museo Entomologico de Leonlocation not on record	4
Guangzhou, CN	4
University of Stellenboschlocation not on record	4
Xiamen, CN	3
Pondicherry, IN	3
Saint Louis, US	3
Birla Institute of Technology - Pilani, K.K.Birla Goa Campuslocation not on record	3
Fort Worth, US	2
Changsha, CN	2
Vietnam Academy of Science and Technology (VAST)location not on record	1
Cibinong, ID	1
SCAUlocation not on record	1
Servico de Microbiologia e Imunologialocation not on record	1
Guilin, CN	1
Armidale, AU	1
James Cook Townsvillelocation not on record	1
Palmerston, AU	1
Llocation not on record	1
Bloomington, US	1

28 institutions · 139 of 316 vouchered records shown · 155 without an institution code

09Environmental DNA7 detections

Where the DNA of Sonneratia caseolaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

Coastal

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 25.1–25.7

Seasonal swing summer↔winter3.80 °C

Max temp (day)30.9 °C 30.5–31.2

Min temp (night)20.8 °C 19.6–21.2

Precipitation5.50 mm/mo 2.50–77.8

Air humidity53.3 % 52.4–54.0

Moisture balance-120 mm/mo -126–-48.4

Vapour deficit1,532 Pa 1,472–1,591

Wind speed2.30 m/s 1.90–2.30

Cloud cover10.6 % 9.00–20.9

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)