Sonneratia apetala

Buch.-Ham. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Lythraceae/Sonneratia

At a glance

Occurrence records201

Data sources11

Biological traits16

DNA specimens5

eDNA detections5

Sources11 archives

Databases and archives Sonneratia apetala's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility198 records↗

OBISOcean Biodiversity Information System3 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF · OBIS201 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB325 Mbp

01Narrative

Sonneratia apetala là một loài thực vật có hoa trong họ Lythraceae. Loài này được Buch.-Ham. miêu tả khoa học đầu tiên năm 1800.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height17.5 m

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTforest, wetland

Woodinesswoody

Physiology & chemistry4

Leaf p3.2 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density529 mg/cm³

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sonneratia apetala has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLOK635203.1 ↗570 bpChina · 2019

ACGT

TATACTCCTGAATATCAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGGCTGAGGAAGCAGGG …

Sonneratia apetala isolate GXMW_789 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL10★ITS

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Sonneratia apetala carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size325 334 693 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sonneratia apetala0.33 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–242n range20median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · book-indian_vol1 · CCDB · book-fedorov

CCDB · book-indian_vol1 — Raghavan, R.S. 1959b

CCDB · book-fedorov — Raghavan R. S. 1959b

2n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Wang, R. j., Z. y. Chen & X. x. Huang. 1998. Chromosome counts on Chinese mangroves. J. Trop. & Subtrop. Bot. 6(1): 40–46.

2n 241×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Sidhu, S.S. 1961

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type201 records

Wild obs. + sensor88

Museum / vouchered112

Other1

Range

Area of Occupancy AOO400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 25≤1 km 20≤10 km 7>10 km 1

53 georeferenced · 35 without coordinates

Open the mapobservation + sensor88

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 112 records without

Open the institutions mapphysical evidence112

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	25
South Kensington, GB	2
South China Normal Universitylocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1
Cambridge, US	1

5 institutions · 30 of 112 vouchered records shown · 80 without an institution code

09Environmental DNA5 detections

Where the DNA of Sonneratia apetala was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.4 °C 25.6–28.6

Seasonal swing summer↔winter13.3 °C

Max temp (day)30.2 °C 28.8–30.4

Min temp (night)25.7 °C 20.6–26.0

Precipitation291 mm/mo 145–356

Air humidity66.0 % 54.8–66.3

Moisture balance187 mm/mo

Vapour deficit1,337 Pa 1,256–1,560

Wind speed2.60 m/s

Cloud cover25.2 % 16.7–47.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)