Sonneratia alba

Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Lythraceae/Sonneratia

At a glance

Occurrence records3 126

Data sources15

Biological traits36

DNA specimens24

eDNA detections17

Sources15 archives

Databases and archives Sonneratia alba's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 429 records↗

OBISOcean Biodiversity Information System697 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Chemical compositionLOTUS · NPASS139 compounds

Occurrence & distributionGBIF · OBIS3 126 records

Environmental DNA1 datasets · 8 countries17 detections

DNA & barcodingBOLD · NCBI24 specimens

Genome at a glanceCCDB · GoaT · NCBI283 Mbp

01Narrative

Sonneratia alba (Sm., 1816) è una pianta appartenente alla famiglia delle Lythraceae, diffusa nelle foreste di mangrovie dell'oceano Indiano e del Pacifico centro-occidentale.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology12

Fruit length31 mm

⚠ sources differ — AusTraits: 31 mm · GIFT: 22.5 mm

Fruit length max25 mm

Fruit length min20 mm

Fruit width28.5 mm

Leaf length95 mm

Leaf width51 mm

Petiole length1.05 cm

Plant height16 m

⚠ sources differ — GIFT: 16 m · AusTraits: 6.5 m · TRY: 4 m

Plant height max30 m

Plant height min3 m

Seed length12 mm

Seed width5.5 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typewater

Flowering timennyyyyyyyynn

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromebat

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formtree

Habitat GIFThalophytic vegetation

Leaf compoundnesssimple

Leaf shapeobovate orbicular ovate

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)6.32 mm²/mg

Wood density509 mg/cm³

03Chemical composition139 compounds

Compounds documented for Sonneratia alba across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Bisnaphthalenes15

Unsaturated fatty acids11

Hydrocarbons9

Simple aromatic polyketides9

Drimane sesquiterpenoids8

Documented compounds139 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,12aR,12bR)-1,4,9,12a-tetrahydroxy-2,12b-dihydro-1H-perylene-3,10-dione	present	LOTUS
(1R,12aS,12bR)-1,4,9,12a-tetrahydroxy-2,12b-dihydro-1H-perylene-3,10-dione	present	LOTUS
(1R,3R)-spiro[2,3-dihydro-1H-naphthalene-4,3'-2,4-dioxatricyclo[7.3.1.05,13]trideca-1(12),5,7,9(13),10-pentaene]-1,3,8-triol	present	NPASS
(1R,4R)-1-oxodithiolan-4-ol	present	NPASS
(1R,4R,5R,9S,10S,13S)-13-hydroxy-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecane-5-carbaldehyde	present	NPASS
(1R,4R,5R,9S,10S,13S)-5-(hydroxymethyl)-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecan-13-ol	present	NPASS
(1R,4S)-1-oxodithiolan-4-ol	present	NPASS
(1R,4S,5R,9S,10R,13S)-13-(hydroxymethyl)-5,9-dimethyl-14-oxotetracyclo[11.2.1.01,10.04,9]hexadecane-5-carbaldehyde	present	NPASS
(1R,4S,5R,9S,10R,13S)-13-hydroxy-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecane-5-carbaldehyde	present	NPASS
(1R,4S,5R,9S,10R,13S)-5-(hydroxymethyl)-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecan-13-ol	present	NPASS

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sonneratia alba has left across the world's sequence archives.

At a glance

DNA specimens24

Marker genes6

GenBank sequences10

eDNA detections17

Countries8

The DNA barcodea real sequence read deposited for this species

ITSOQ696030.1 ↗639 bpIndonesia · 2021

ACGT

GGTGAACCTGCGGAAGGATCATTGTCGATACCTGCAAGAGCAGAACGACCCGTGAACATGTGAACACAATGCTGGCCGGGCGGGCACATG …

UNVERIFIED: Sonneratia alba isolate T129 internal transcribed spacer region, partial sequence; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★matK-like★rbcL7★rbcLa★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Sonneratia alba carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size283 420 408 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sonneratia alba0.28 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Wang, R. j., Z. y. Chen & X. x. Huang. 1998. Chromosome counts on Chinese mangroves. J. Trop. & Subtrop. Bot. 6(1): 40–46.

n 111×CCDB · book-ipcn66

CCDB · book-ipcn66 — Muller & Hon-Liu 1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness94.8% BUSCO

08Occurrence & distribution

Record type3 126 records

Wild obs. + sensor1 999

Museum / vouchered1 040

Cultivated / captive3

Other84

Origin

Native14

Range

Area of Occupancy AOO4 676 km²

Depth

0–200 m sunlit519

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal9

median 0 m · max 4 850 m · 528 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 417≤1 km 894≤10 km 136>10 km 30

1 477 georeferenced · 522 without coordinates

Open the mapobservation + sensor1 999

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 34≤1 km 17≤10 km 241>10 km 24

316 georeferenced · 724 without coordinates

Open the institutions mapphysical evidence1 040

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 56 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	123
Palmerston, AU	62
Tsukuba, JP	39
Paris, FR	28
Smithfield, AU	26
University of Stellenboschlocation not on record	25
Canberra, AU	24
Plocation not on record	24
Saint Louis, US	23
Pondicherry, IN	19
Nishihara, JP	19
Kensington, AU	17
Kew, GB	15
Museo Entomologico de Leonlocation not on record	15
Bronx, US	14
Mount Annan, AU	11
Honolulu, US	9
Fort Worth, US	9
Zürich, CH	9
Guangzhou, CN	6
Moscow State Universitylocation not on record	6
Xiamen, CN	5
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	5
Instituto de Investigação Científica Tropicallocation not on record	4
Nishihara, JP	4
MeiseBGlocation not on record	3
John T. Waterhouse Herbariumlocation not on record	3
Australian Institute of Marine Sciencelocation not on record	3
Stockholm, SE	3
Adelaide, AU	3
Llocation not on record	3
Claremont, US	2
CJBGlocation not on record	2
Birla Institute of Technology - Pilani, K.K.Birla Goa Campuslocation not on record	2
TAFORI-LSRClocation not on record	2
TNMlocation not on record	2
BISHlocation not on record	2
Wlocation not on record	2
Seychelles National Herbariumlocation not on record	2
Armidale, AU	2
EL PASO, US	2
Glocation not on record	2
Cibinong, ID	2
Buffelskloof Private Nature Reserve, Herbariumlocation not on record	1
Sokoine University of Agriculturelocation not on record	1
Nagano City, JP	1
Arusha, TZ	1
Berlin, DE	1
Eduardo Mondlane Universitylocation not on record	1
WAGlocation not on record	1
TAIElocation not on record	1
James Cook Townsvillelocation not on record	1
Cambridge, US	1
Clocation not on record	1
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
South Kensington, GB	1

56 institutions · 596 of 1 040 vouchered records shown · 341 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA17 detections

Where the DNA of Sonneratia alba was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map8 countries0

Coastal

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 10.0–27.4

Seasonal swing summer↔winter10.4 °C

Max temp (day)29.2 °C 15.7–31.7

Min temp (night)19.3 °C 3.10–23.2

Precipitation14.7 mm/mo 7.30–333

Air humidity53.8 % 45.7–67.6

Moisture balance-95.2 mm/mo -126–192

Vapour deficit1,100 Pa 827–1,591

Wind speed2.60 m/s 1.00–4.50

Cloud cover24.1 % 12.9–48.3

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sonneratia alba

At a glance

Sources15 archives

Size & morphology12

Life cycle & reproduction8

Diet & foraging1

Habitat & environment11

Physiology & chemistry4

Compound class profile5 classes

Documented compounds139 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type3 126 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions30 of 56 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 126 records