Sonchus wightianus

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Sonchus

At a glance

Occurrence records141

Data sources9

Biological traits16

DNA specimens9

eDNA detections4

Sources9 archives

Databases and archives Sonchus wightianus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility141 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources16 traits

Occurrence & distributionGBIF141 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Sonchus wightianus is an Asian species of plants in the tribe Cichorieae within the family Asteraceae. It is widespread across much of Asia, found in China, the Indian Subcontinent, and Southeast Asia as far south as Indonesia.Flora of China, Sonchus wightianus Candolle, 1838. 苣荬菜 ju mai cai Sonchus wightianus is a perennial herb up to 150 cm tall. Stems and the bracts around the flower heads have many purple hairs. The plant produces flat-topped arrays of several flower heads, each head with 180-300 yellow ray flowers but no disc flowers.タイワンハチジョウナ　台湾八丈菜, 学名 Sonchus wightianus DC., 中国名苣荬菜 ju mai cai in Chinese with numerous color photos

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology3

Fruit length3 mm

Fruit length max3 mm

Fruit length min3 mm

Life cycle & reproduction3

Life formperennial

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 500 m

Elevation mean1 225 m

Elevation min50 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sonchus wightianus has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences7

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPQ860632.1 ↗216 bpChina · 2024

ACGT

CGCATCGCGTCGCCCCCCTCCCCCGCGGGGTGGGGCGGAGATTGGCCCCCCGTGCGACCCGAGCGCGCGCGGCCGGCCCAAATGCGAATC …

Sonchus wightianus voucher JN-15 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Sonchus wightianus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · eflora

CCDB · eflora

n 92×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1988. Chromosome numbers in Compositae from Pakistan. Candollea 43: 455–465.

CCDB · ipcn-api-dl — Razaq, Z. A., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800–808.

n 101×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Razaq, Z. A., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800–808.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.996 ↗

08Occurrence & distribution

Record type141 records

Wild obs. + sensor70

Museum / vouchered68

Other3

Origin

Native2

Range

Area of Occupancy AOO480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 16≤1 km 10≤10 km 1

27 georeferenced · 43 without coordinates

Open the mapobservation + sensor70

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 1≤10 km 1>10 km 3

5 georeferenced · 63 without coordinates

Open the institutions mapphysical evidence68

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	15
Tsukuba, JP	8
Moscow State Universitylocation not on record	6
San José, CR	5
Nishihara, JP	4
GMBAlocation not on record	3
Herbarium of South China Botanical Gardenlocation not on record	3
Osaka, JP	2
Berlin, DE	2
Herbarium of the Department of Botany, University of Tokyolocation not on record	2
Beijing, CN	1
Paris, FR	1
Stockholm, SE	1
Nishihara, JP	1
Cambridge, US	1
Xiamen, CN	1
Kagoshima, JP	1
Kunming, CN	1
Kew, GB	1
University of Stellenboschlocation not on record	1
Natural History Museum, Tribhuvan Universitylocation not on record	1
Nagano City, JP	1

22 institutions · 62 of 68 vouchered records shown · 6 without an institution code

09Environmental DNA4 detections

Where the DNA of Sonchus wightianus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

Grassland hillsidePine forestGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.8 °C 17.4–24.5

Seasonal swing summer↔winter25.0 °C

Max temp (day)25.1 °C 20.3–30.2

Min temp (night)16.8 °C 13.0–18.2

Precipitation111 mm/mo 25.5–656

Air humidity57.7 % 44.2–72.0

Moisture balance-13.4 mm/mo -126–567

Vapour deficit1,019 Pa 611–1,731

Wind speed2.60 m/s 1.40–3.80

Cloud cover36.6 % 29.9–50.9

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)