Sonchus ustulatus

Lowe · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Sonchus

At a glance

Occurrence records92

Data sources11

Biological traits5

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Sonchus ustulatus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility92 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources5 traits

Chemical compositionLOTUS9 compounds

Occurrence & distributionGBIF92 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT1.5 Gbp

01Narrative

Sonchus ustulatus, also known as a leituga, is a species of herb in the Asteraceae family. It has been found near or on islands owned by Portugal and Spain. It produces oxygen and grows to be around 0.2 meters.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology1

Plant height0.2 m

Life cycle & reproduction2

Life spanannual

Lifespan years6 years

Habitat & environment2

Growth formherb

Woodinessnon-woody

03Chemical composition9 compounds

Compounds documented for Sonchus ustulatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavones7

Simple coumarins2

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(3R,4R,6S)-6-[[(2R,3S,4S,5R,6S)-6-[2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxochromen-7-yl]oxy-3,4,5-trihydroxyoxan-2-yl]methoxy]-3,4,5-trihydroxyoxane-2-carboxylic acid	present	LOTUS
(3S,4S,6S)-3,4,5-trihydroxy-6-[5-hydroxy-2-(4-hydroxyphenyl)-4-oxochromen-7-yl]oxyoxane-2-carboxylic acid	present	LOTUS
Aesculetin	present	LOTUS
Apigenin-7-rutinoside	present	LOTUS
Apiumetrin	present	LOTUS
Luteolin 7-glucoside	present	LOTUS
Luteolin 7-glucuronide	present	LOTUS
Luteolin rutinoside	present	LOTUS
Scopoletin	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sonchus ustulatus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences7

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSL48118.1 ↗222 bp

ACGT

TCGCGTCGCCCCCCGCCAAACATCCCCAAAGGTAATCATGGTGATGGGGGCGGAAATTGGCCTCCCGTTCTTGTGTCCGGTTGGCCTAAA …

Sonchus ustulatus subsp. ustulatus internal transcribed spacer 2 (ITS2); putative, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Sonchus ustulatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 462 110 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sonchus ustulatus1.46 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Garcia S, Hidalgo O, Jakovljević I, Siljak-Yakovlev S, Vigo J, Garnatje T, Vallès J. 2013. New data on genome size in 128 Asteraceae species and subspecies, with first assessments for 40 genera, 3 tribes and 2 subfamilies. Plant Biosystems 147: 1219-1227.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type92 records

Wild obs. + sensor85

Museum / vouchered7

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 38≤1 km 8≤10 km 7>10 km 1

54 georeferenced · 31 without coordinates

Open the mapobservation + sensor85

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	4
MAlocation not on record	2
Entomological Society of Latvialocation not on record	1

3 institutions · 7 of 7 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Sonchus ustulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)