Sonchus tenerrimus
speciesAt a glance
Occurrence records26 828
Data sources13
Biological traits38
DNA specimens11
eDNA detections9
Sources13 archives
Databases and archives Sonchus tenerrimus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility26 828 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics11 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources38 traits
Chemical compositionLOTUS7 compounds
Occurrence & distributionGBIF26 828 records
Environmental DNA1 datasets · 4 countries9 detections
DNA & barcodingBOLD · NCBI11 specimens
Genome at a glanceCCDB · GoaT1 Gbp
01Narrative
Sonchus tenerrimus est une espèce de plante à fleurs de la famille des Astéracées d'origine méditerranéenne.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology6
Fruit length max3.5 mm
Fruit length min2.5 mm
Plant height0.24 m
Plant height max1 m
Plant height min0.1 m
Seed mass0.055 mg
⚠ sources differ — TRY: 0.055 mg · GIFT: 0.3 mg
Life cycle & reproduction13
Dehiscenceindehiscent
Dispersal typewind
Flower colouryellow
Flowering endDec
Flowering startApr
Life formannual, biennial or perennial
Life spanperennial
⚠ sources differ — TRY: Perennial · GIFT: annual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max1 900 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Leaf formelliptic
Succulenceyes
Woodinessnon-woody
Physiology & chemistry2
Photosynthetic pathwayC3
Specific leaf area (SLA)16.55 mm²/mg
Other traits4
Inflorescenceraceme
Leaf arrangementalternate
Plant support typefree-standing
Seeds per fruit>1000
03Chemical composition7 compounds
Compounds documented for Sonchus tenerrimus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Flavones5
Simple coumarins2
Documented compounds7 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (3R,4R,6S)-6-[[(2R,3S,4S,5R,6S)-6-[2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxochromen-7-yl]oxy-3,4,5-trihydroxyoxan-2-yl]methoxy]-3,4,5-trihydroxyoxane-2-carboxylic acid | present | LOTUS | |
| (3S,4S,6S)-3,4,5-trihydroxy-6-[5-hydroxy-2-(4-hydroxyphenyl)-4-oxochromen-7-yl]oxyoxane-2-carboxylic acid | present | LOTUS | |
| Aesculetin | present | LOTUS | |
| Apiumetrin | present | LOTUS | |
| Luteolin 7-glucoside | present | LOTUS | |
| Luteolin 7-glucuronide | present | LOTUS | |
| Scopoletin | present | LOTUS |
05DNA & barcoding11 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sonchus tenerrimus has left across the world's sequence archives.
At a glance
DNA specimens11
Marker genes5
GenBank sequences10
eDNA detections9
Countries5
The DNA barcodea real sequence read deposited for this species
ATCGCGTCGCCCCCCACCAAGCATCCTTAAGGGGTAATCATGGTGATGGGGCGGAAATTGGCCTCCCGTTCTTGTGTTTGGTTGGCCTAA …
Sonchus tenerrimus voucher VAL38120 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK5★rbcL3★rbcLa★ITS2★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Sonchus tenerrimus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 007 340 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Sonchus tenerrimus1.01 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidydiploid inferred
Chromosome records14–142n range14median14mode33records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1433×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · iber-fl +11
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — LARSEN K. - 1956. Chromosome studies in some Mediterranean and South European flowering plants.. Bot. Not. , 109(3): 293-307.
CCDB · ita-fl — PAVONE P., TERRASI M.C., ZIZZA A. - 1981. Numeros cromosomaticos de plantas occidentales 113-128.. Anales Jard. Bot. Madrid , 38(1): 273-280.
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · iber-fl — Chromosome numbers in Iberian angiosperms. Bjorkqvist, I. & al.Bot. Not.122: 271-283(1969).
CCDB · iber-fl — Diferencias cariolgicas y morfolgicas entre Sonchus pustulatus Willk. y Sonchus tenerrimus L. Mejas, J. A.Lagascalia15(Extra): 345-354(1988).
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 211-222. Castroviejo, S.Anales Jard. Bot. Madrid39(2): 525-531(1983).
CCDB · iber-fl — Palynological and cytological observations in Spanish Sonchus (Asteraceae). Mejas, J. A. & M. J. Dez.Grana32: 343-347(1993).
CCDB · iber-fl — Estudio citotaxonmico de algunas especies de las Islas Mediterrneas. Cardona, M. A.Lagascalia4(2): 213-220(1974).
CCDB · fl-europaea — Larsen, 1956a
CCDB · ipcn-api-dl — Mejías, J. A. 1988. Diferencias cariológicas y morfológicas entre Sonchus pustulatus Willk. y Sonchus tenerrimus L. Lagascalia 15 (Extra): 345–354.
CCDB · ipcn-api-dl — Pavone, P., M. C. Terrasi & A. Zizza. 1981. Números cromosomáticos de plantas occidentales, 113-128. Anales Jard. Bot. Madrid 38: 273–280.
CCDB · ipcn-api-dl — Castroviejo, S. 1983. Numeros cromosomaticos de plantas occidentales, 211--222. Anales Jard. Bot. Madrid 39: 525–531.
CCDB · ipcn-api-dl — Oberprieler, C. & R. Vogt. 1993. Chromosome numbers of north African phanerogams. II. Willdenowia 23: 211–238.
CCDB · book-ipcn67-71 — BJ.ORKQVIST, I . , R. VON BOTHMER, O. NILSSON: & B. NORDENSTAM. 1969. Chromosome numbers in Iberian Angiosperms. Bot. Notiser 122: 271-28;
CCDB · book-ipcn73-74 — CARDONA, M.A. 1974. Estudio citot~onomico de algunas especies de las islas Medes, Baleares, Corcega y Cerdena. Lagascalia 4: 213-220.
CCDB · book-ipcn73-74 — NORDENSTAM, B. 1972. Chromosome numbers in some Compositae from Egypt. Bot. Notiser 125: 393-396.
CCDB · eflora
CCDB · book-fedorov — Stebbins et al. 1953
CCDB · book-fedorov — Larsen 1956b
CCDB · book-atlas-flowering-plants — Stebbins et al. 1953
CCDB · kew — Garcia S, Hidalgo O, Jakovljević I, Siljak-Yakovlev S, Vigo J, Garnatje T, Vallès J. 2013. New data on genome size in 128 Asteraceae species and subspecies, with first assessments for 40 genera, 3 tribes and 2 subfamilies. Plant Biosystems 147: 1219-1227.
CCDB · Oberlander2016 — Pavone, Terrasi, Zizza, 1981;Gallego Cidoncha, 1985;Castroviejo, 1983;Mejias, 1988;Ruiz de Clavijo, 1990;Oberprieler & Vocht, 1993
CCDB · Cave1956 — Larsen a
CCDB · CromoCat 2015 — Oberprieler, C. & R. Vogt. (1993). Chromosome numbers of north African phanerogams. II. Willdenowia 23: 211-238.
CCDB · CromoCat 2015 — Björkqvist, I., von Bothmer, R., Nilsson, O. & Nordenstam, B. (1969). Chromosome numbers in Iberian angiosperms. Bot. Not. 122: 271-283.
CCDB · CromoCat 2015 — Castroviejo, S. (1983). Números cromosomáticos de plantas occidentales, 211-222. Anales Jard. Bot. Madrid 39(2): 525-531.
CCDB · CromoCat 2015 — Larsen, K. (1956a). Chromosome studies in some Mediterranean and south European flowering plants. Bot. Not. 109(3): 293-307.
CCDB · CromoCat 2015 — Mejías, J. A. & M. J. Díez. (1993). Palynological and cytological observations in Spanish Sonchus (Asteraceae). Grana 32: 343-347.
CCDB · CromoCat 2015 — Mejías, J. A. (1988). Diferencias cariológicas y morfológicas entre Sonchus pustulatus Willk. y Sonchus tenerrimus L. Lagascalia 15(Extra): 345-354.
CCDB · CromoCat 2015 — Nordenstam, B. (1972). Chromosome numbers in some Compositae from Egypt. Bot. Not. 125: 393-396.
CCDB · CromoCat 2015 — Pavone, P., C. M. Terrasi & A. Zizza. (1981a). Números cromosomáticos de plantas occidentales, 113-128. Anales Jard. Bot. Madrid 38: 273-280.
CCDB · CromoCat 2015 — Roux, J. & L. Boulos. (1972). Révision systématique du genre Sonchus L. s. l. II. Étude caryologique. Bot. Not. 125: 306-309.
n 712×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +1
CCDB · iber-fl — Diferencias cariolgicas y morfolgicas entre Sonchus pustulatus Willk. y Sonchus tenerrimus L. Mejas, J. A.Lagascalia15(Extra): 345-354(1988).
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 608-618. Ruz de Clavijo Jimnez, E.Anales Jard. Bot. Madrid47(2): 425-430(1990).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 404-408. Gallego Cidoncha, M. J.Lagascalia13(2): 311-313(1985).
CCDB · iber-fl — Palynological and cytological observations in Spanish Sonchus (Asteraceae). Mejas, J. A. & M. J. Dez.Grana32: 343-347(1993).
CCDB · ipcn-api-dl — Mejías, J. A. 1988. Diferencias cariológicas y morfológicas entre Sonchus pustulatus Willk. y Sonchus tenerrimus L. Lagascalia 15 (Extra): 345–354.
CCDB · ipcn-api-dl — Gallego Cidoncha, M. J. 1985. Números 404-408, in Números cromosómicos para la flora española. 363-434. Lagascalia 13: 311–313.
CCDB · ipcn-api-dl — Ruíz de Clavijo, E. 1990. Números cromosomáticos de plantas occidentales, 608--618. Anales Jard. Bot. Madrid 47: 425–430.
CCDB · book-ipcn72 — DELAY, J. , & D. PETIT. 1971. Littoral Atlantique du Ma roe. Inf. Ann. Caryosyst. et Cytogenet. 5: 1-16.
CCDB · CromoCat 2015 — Gallego, M. J. (1985). Números cromosómicos para la flora española, 404-408. Lagascalia 13(2): 311-313.
CCDB · CromoCat 2015 — Mejías, J. A. & M. J. Díez. (1993). Palynological and cytological observations in Spanish Sonchus (Asteraceae). Grana 32: 343-347.
CCDB · CromoCat 2015 — Mejías, J. A. (1988). Diferencias cariológicas y morfológicas entre Sonchus pustulatus Willk. y Sonchus tenerrimus L. Lagascalia 15(Extra): 345-354.
CCDB · CromoCat 2015 — Ruíz de Clavijo Jiménez, E. (1990b). Números cromosomáticos de plantas occidentales, 608-618. Anales Jard. Bot. Madrid 47(2): 425-430.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Oberprieler, C. & R. Vogt. (1993). Chromosome numbers of north African phanerogams. II. Willdenowia 23: 211-238.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type26 828 records
Wild obs. + sensor23 645
Museum / vouchered1 678
Cultivated / captive1
Other1 504
Origin
Native5 596
Introduced71
Range
Area of Occupancy AOO34 340 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy67% within 1 km
≤100 m 3 820≤1 km 9 092≤10 km 6 131>10 km 141
19 184 georeferenced · 4 461 without coordinates
Open the mapobservation + sensor23 645
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy64% within 1 km
≤100 m 93≤1 km 315≤10 km 226>10 km 4
638 georeferenced · 1 040 without coordinates
Open the institutions mapphysical evidence1 678
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions58 of 97 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Berlin, DE | 253 |
| València, ES | 151 |
| LDlocation not on record | 116 |
| BIO-UNIPIlocation not on record | 115 |
| BDBClocation not on record | 103 |
| BClocation not on record | 97 |
| San Diego, US | 72 |
| MAlocation not on record | 60 |
| UIBlocation not on record | 58 |
| Barcelona, ES | 58 |
| College of the Atlantic, Museumlocation not on record | 44 |
| Sevilla, ES | 41 |
| Phyletisches Museum Jenalocation not on record | 38 |
| ISAlocation not on record | 34 |
| Vitoria, ES | 30 |
| Granada, ES | 27 |
| Badajoz, ES | 23 |
| CICYTEXlocation not on record | 21 |
| Alicante, ES | 20 |
| Wlocation not on record | 13 |
| Paris, FR | 13 |
| CJBGlocation not on record | 13 |
| Kew, GB | 13 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 11 |
| Salamanca, ES | 9 |
| Jaén, ES | 8 |
| San Sebastián, ES | 8 |
| Entomological Society of Latvialocation not on record | 8 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| Riverside, US | 8 |
| EEZA-CSIClocation not on record | 7 |
| Calabar, NG | 7 |
| Austin, US | 7 |
| Sendai, JP | 6 |
| Museo Entomologico de Leonlocation not on record | 6 |
| Madrid, ES | 6 |
| Córdoba, ES | 5 |
| Moscow State Universitylocation not on record | 5 |
| Santa Barbara, US | 5 |
| Saint Louis, US | 5 |
| Mexico City, MX | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| Pamplona, ES | 4 |
| MeiseBGlocation not on record | 4 |
| Frankfurt am Main | 4 |
| Nijmegen, NL | 4 |
| Mount Annan, AU | 3 |
| Adelaide, AU | 3 |
| Bronx, US | 3 |
| BRNUlocation not on record | 3 |
| Davis, US | 3 |
| Museo Achille Folettolocation not on record | 3 |
| South Kensington, GB | 3 |
| SLU Artdatabankenlocation not on record | 3 |
| UChlocation not on record | 3 |
| Stockholm, SE | 2 |
| Los Angeles, US | 2 |
| Claremont, US | 2 |
| Dresden, DE | 2 |
| Ensenada, MX | 2 |
| CASlocation not on record | 2 |
| Cape Town, ZA | 2 |
| University of Stellenboschlocation not on record | 2 |
| PRClocation not on record | 2 |
| Mexico City, MX | 2 |
| Turlock, US | 2 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| OLAlocation not on record | 1 |
| Uppsala, SE | 1 |
| Moscow, US | 1 |
| Orto botanico dell'Università degli Studi di Catanialocation not on record | 1 |
| Lausanne, CH | 1 |
| Culiacán, MX | 1 |
| Córdoba, AR | 1 |
| San Isidro, AR | 1 |
| JBSlocation not on record | 1 |
| RJBJCIlocation not on record | 1 |
| La Paz, MX | 1 |
| Hobart, AU | 1 |
| The University of Arizonalocation not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Karlsruhe, DE | 1 |
| Bourges, FR | 1 |
| GJOlocation not on record | 1 |
| Coimbra, PT | 1 |
| Pretoria, ZA | 1 |
| Provincia di Livornolocation not on record | 1 |
| Görlitz, DE | 1 |
| Rishon Le Zion, IL | 1 |
| Phoenix, US | 1 |
| Monastir, TN | 1 |
| Irvine, US | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Vancouver, CA | 1 |
| Pamplona, ES | 1 |
97 institutions · 1 636 of 1 678 vouchered records shown · 35 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA9 detections
Where the DNA of Sonchus tenerrimus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found9
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 9 detections have coordinates
Open the map4 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.2 °C 14.5–18.0
Seasonal swing summer↔winter19.6 °C
Max temp (day)20.1 °C 18.9–23.7
Min temp (night)9.30 °C 9.00–12.2
Precipitation70.4 mm/mo 26.3–72.2
Air humidity57.7 % 49.1–58.3
Moisture balance-28.0 mm/mo -94.0–-20.6
Vapour deficit804 Pa 782–1,222
Wind speed2.60 m/s 2.00–3.30
Cloud cover40.9 % 30.2–41.2
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.