Sonchus oleraceus
speciesAt a glance
Occurrence records546 875
Data sources12
Biological traits78
DNA specimens125
eDNA detections68
Sources12 archives
Databases and archives Sonchus oleraceus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility546 875 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI68 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics125 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources78 traits
Chemical compositionLOTUS · NPASS51 compounds
Occurrence & distributionGBIF546 875 records
Environmental DNA2 datasets · 16 countries68 detections
DNA & barcodingBOLD · NCBI125 specimens
Genome at a glanceGIFT · GoaT1.7 Gbp
01Narrative
Sonchus oleraceus, communément appelé le Laiteron maraîcher, Laiteron commun, Laiteron lisse ou Laiteron potager, est une espèce de plantes à fleurs du genre Sonchus et de la famille des Asteraceae. L’espèce est originaire d’Europe, d’Afrique du Nord et du Moyen-Orient et a été introduite dans presque tous les autres pays du monde. C’est une rudérale que l’on trouve dans les champs, les jardins, les décombres, les friches, les bords de route ou les bords de trottoir en ville. Les feuilles peuvent être consommées crues ou cuites.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology28
Fruit length3 mm
Fruit length max3.5 mm
Fruit length min2 mm
Fruit width0.75 mm
⚠ sources differ — AusTraits: 0.75 mm · GIFT: 1 mm
Fruit width max1 mm
Fruit width min0.6 mm
Leaf length120 mm
Leaf length max350 mm
Leaf length min40 mm
Leaf mass88.6 mg
⚠ sources differ — AusTraits: 88.6 mg · LEDA: 341 mg
Leaf mass per area29.99 g/m2
Leaf size1 125 mm²
⚠ sources differ — TRY: 1 125 mm² · AusTraits: 2 059 mm² · LEDA: 10 612 mm² · GIFT: 10 612 mm²
Leaf width60 mm
⚠ sources differ — AusTraits: 60 mm · GIFT: 70 mm
Leaf width max150 mm
Leaf width min10 mm
Plant height0.975 m
⚠ sources differ — GIFT: 0.975 m · AusTraits: 0.8 m · LEDA: 0.9 m · TRY: 0.87 m
Plant height generative0.8 m
Plant height max3.05 m
Plant height min0.1 m
Seed length3.2 mm
Seed length max3.2 mm
Seed length min3.2 mm
Seed mass0.313 mg
⚠ sources differ — TRY: 0.313 mg · AusTraits: 0.252 mg · LEDA: 0.278 mg · GIFT: 0.328 mg
Seed mass max0.55 mg
Seed mass min0.119 mg
Seed volume1.2 mm³
Seed volume max1.2 mm³
Seed volume min1.2 mm³
Life cycle & reproduction19
Deciduousnesssemi-evergreen
⚠ sources differ — TRY: semi-evergreen · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: anemochorous
Flower colourbrown
Flowering endOct
Flowering startJun
Flowering timeyyyyyyyyyyyy
Life formannual or biennial
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Reproductive maturity0.288 years
Resprouting capacityfire_killed
Seed number6 100
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment17
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 900 m
Elevation mean1 685 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Campo Limpo, Cerrado (lato sensu)
Leaf compoundnesssimple
Leaf formpinnatipartite
Leaf shapelanceolate oblanceolate
Mycorrhiza typearbuscular
Succulenceno
Woodinessnon-woody
Physiology & chemistry8
Leaf c402 mg/g
Leaf dry-matter content (LDMC)133 mg/g
⚠ sources differ — TRY: 133 mg/g · LEDA: 118 mg/g
Leaf n32.29 mg/g
Leaf p3.46 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)33.69 mm²/mg
⚠ sources differ — TRY: 33.69 mm²/mg · LEDA: 37.6 mm²/mg · GIFT: 40.53 mm²/mg
Other traits4
Diaspore typeone-seeded generative dispersule
Inflorescenceraceme
Leaf arrangementalternate
Seeds per fruit>1000
03Chemical composition51 compounds
Compounds documented for Sonchus oleraceus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Germacrane sesquiterpenoids8
Flavones7
Cinnamic acids and derivatives5
Guaiane sesquiterpenoids4
Simple coumarins3
Documented compounds51 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Eriodictyol | present | NPASS | |
| (2E)-3-phenyl-2-propen-1-yl-6-O-(6-deoxy-alpha-L-mannopyranosyl)-beta-D-glucopyranoside | present | NPASS | |
| (3aS,5aR,6R,9aS,9bS)-5a-methyl-3,9-dimethylidene-6-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,6,7,8,9a,9b-octahydrobenzo[g][1]benzofuran-2-one | present | LOTUS | |
| (3aS,5R,6aR,8S,9aR,9bS)-5-hydroxy-3,6,9-trimethylidene-8-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-2-one | present | LOTUS | |
| (3aS,6E,10Z,11aR)-6-methyl-3-methylidene-10-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-2-one | present | LOTUS | |
| (3aS,6E,9R,10E,11aR)-6,10-dimethyl-3-methylidene-9-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-2-one | present | LOTUS | |
| (3aS,6E,9S,10E,11aS)-6,10-dimethyl-3-methylidene-9-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-2-one | present | LOTUS | |
| (3R,4R,6S)-6-[[(2R,3S,4S,5R,6S)-6-[2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxochromen-7-yl]oxy-3,4,5-trihydroxyoxan-2-yl]methoxy]-3,4,5-trihydroxyoxane-2-carboxylic acid | present | LOTUS | |
| (3S,3aR,4S,6Z,10Z,11aR)-4-hydroxy-3-methyl-2-oxo-10-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]-3a,4,5,8,9,11a-hexahydro-3H-cyclodeca[b]furan-6-carbaldehyde | present | LOTUS | |
| (3S,3aS,6E,9R,10E,11aS)-3,6,10-trimethyl-9-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,8,9,11a-hexahydro-3H-cyclodeca[b]furan-2-one | present | LOTUS |
05DNA & barcoding125 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sonchus oleraceus has left across the world's sequence archives.
At a glance
DNA specimens125
Marker genes11
GenBank sequences10
eDNA detections68
Countries16
The DNA barcodea real sequence read deposited for this species
CGCATCGCGTCGCCCCCCGCCAAACATCCTTAAAGGGTAATCATGGTGATGGGGCGGAAAATGGCTTCCCGTTCTTGTTTCCGGTTGGCC …
Sonchus oleraceus voucher YZ-3 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL2★rbcLa★trnL-F★ITS7★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceGIFT · GoaT
The complete instruction manual Sonchus oleraceus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 672 380 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Sonchus oleraceus1.67 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidy4× tetraploid · measured
Chromosome records16–362n range32median32mode6records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 323×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
GIFT · GIFT (floras)
2n 161×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 181×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 361×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
08Occurrence & distribution
Record type546 875 records
Wild obs. + sensor524 433
Museum / vouchered20 085
Cultivated / captive150
Other2 207
Origin
Native37 138
Introduced46 957
Range
Area of Occupancy AOO659 336 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy48% within 1 km
≤100 m 117 142≤1 km 98 846≤10 km 231 695>10 km 3 986
451 669 georeferenced · 72 764 without coordinates
Open the mapobservation + sensor524 433
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy55% within 1 km
≤100 m 2 704≤1 km 3 153≤10 km 4 399>10 km 387
10 643 georeferenced · 9 442 without coordinates
Open the institutions mapphysical evidence20 085
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy2% within 1 km
≤1 km 1≤10 km 43>10 km 16
60 georeferenced · 90 without coordinates
Open the mapnot free-living150
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions334 of 648 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 2 496 |
| Adelaide, AU | 1 138 |
| BIO-UNIPIlocation not on record | 444 |
| BFLlocation not on record | 420 |
| Kensington, AU | 407 |
| Berlin, DE | 397 |
| San Diego, US | 393 |
| LDlocation not on record | 339 |
| Saint Louis, US | 331 |
| Brisbane, AU | 313 |
| ASUlocation not on record | 307 |
| Canberra, AU | 266 |
| Olocation not on record | 252 |
| Durango, MX | 237 |
| Austin, US | 219 |
| Museo Entomologico de Leonlocation not on record | 208 |
| Claremont, US | 191 |
| Odawara, JP | 181 |
| Mexico City, MX | 179 |
| Moscow State Universitylocation not on record | 173 |
| Uniwersytet Warszawskilocation not on record | 166 |
| Riverside, US | 164 |
| Mount Annan, AU | 158 |
| Jardín Botánico de Bogotá José Celestino Mutis (JBB)location not on record | 157 |
| Santa Barbara, US | 150 |
| Hobart, AU | 149 |
| Auckland, NZ | 130 |
| València, ES | 129 |
| Tokushima, JP | 127 |
| Pretoria, ZA | 126 |
| Yangling, CN | 121 |
| Salzburg, AT | 121 |
| Christchurch, NZ | 120 |
| CICYTEXlocation not on record | 110 |
| Philadelphia, US | 109 |
| Chiba, JP | 107 |
| Kew, GB | 104 |
| WTUlocation not on record | 96 |
| College of the Atlantic, Museumlocation not on record | 93 |
| Palmerston, AU | 90 |
| Bronx, US | 88 |
| Adam Mickiewicz University in Poznańlocation not on record | 80 |
| MAlocation not on record | 76 |
| Mexico City, MX | 76 |
| Badajoz, ES | 72 |
| Görlitz, DE | 72 |
| UChlocation not on record | 72 |
| Vitoria, ES | 69 |
| CJBGlocation not on record | 68 |
| Tapachula, MX | 67 |
| Davis, US | 64 |
| Turku, FI | 62 |
| Tampa, US | 62 |
| BDBClocation not on record | 61 |
| University of Stellenboschlocation not on record | 61 |
| Phoenix, US | 61 |
| Chengdu, CN | 60 |
| ISAlocation not on record | 60 |
| Québec, CA | 59 |
| Taipei, TW | 59 |
| Córdoba, ES | 58 |
| Trondheim, NO | 57 |
| Kochi, JP | 55 |
| Oskarshamn, SE | 55 |
| Toyama, JP | 54 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 54 |
| Chongqing Museumlocation not on record | 54 |
| KMNlocation not on record | 53 |
| Barcelona, ES | 51 |
| Entomological Society of Latvialocation not on record | 51 |
| Zacatecas, MX | 50 |
| Oulu, FI | 50 |
| CASlocation not on record | 50 |
| Flagstaff, US | 50 |
| Sanda, JP | 49 |
| Bergen, NO | 49 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 48 |
| Provincia di Livornolocation not on record | 48 |
| SLU Artdatabankenlocation not on record | 47 |
| Puerto Ayora, EC | 46 |
| Université de Strasbourglocation not on record | 46 |
| Ciudad de México, MX | 46 |
| Jena Microbial Resource Collectionlocation not on record | 45 |
| US | 45 |
| TAIElocation not on record | 45 |
| Wellington, NZ | 43 |
| Madison, US | 42 |
| Córdoba, AR | 41 |
| Guangzhou, CN | 41 |
| South Kensington, GB | 41 |
| BClocation not on record | 40 |
| San Luis Obispo, US | 40 |
| San Sebastián, ES | 38 |
| Wuhan, CN | 38 |
| Alicante, ES | 37 |
| Juriquilla, MX | 37 |
| Kagoshima, JP | 36 |
| Ann Arbor, US | 35 |
| Pullman, US | 35 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 35 |
| National Biodiversity Institute, Costa Ricalocation not on record | 35 |
| Granada, ES | 35 |
| Nagano City, JP | 35 |
| Corvallis, US | 34 |
| Bando, JP | 33 |
| Pamplona, ES | 33 |
| Irvine, US | 33 |
| Cape Town, ZA | 32 |
| UIBlocation not on record | 32 |
| Burlington, US | 32 |
| TUR-Alocation not on record | 32 |
| Tartu, EE | 31 |
| EL PASO, US | 31 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 31 |
| Salamanca, ES | 31 |
| NSMKlocation not on record | 31 |
| Beijing, CN | 30 |
| Lanzhou, CN | 30 |
| Chengdu, CN | 30 |
| Wlocation not on record | 29 |
| Canadian Department of Agriculturelocation not on record | 29 |
| Karlsruhe, DE | 28 |
| Armidale, AU | 28 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 27 |
| Durban, ZA | 27 |
| Montréal, CA | 27 |
| Fort Worth, US | 27 |
| BRNUlocation not on record | 27 |
| Bern, CH | 27 |
| BISHlocation not on record | 27 |
| Los Angeles, US | 26 |
| San Isidro, AR | 25 |
| Ishikawa Museum of Natural Historylocation not on record | 24 |
| New Haven, US | 24 |
| Sevilla, ES | 23 |
| University of New Hampshirelocation not on record | 23 |
| Bloomington, US | 23 |
| Guasave, MX | 23 |
| Madrid, ES | 22 |
| TROMlocation not on record | 22 |
| Universidad Nacional de Colombia (UNAL)location not on record | 22 |
| Tomioka, JP | 22 |
| Taipei, TW | 21 |
| Nishihara, JP | 21 |
| WNNUlocation not on record | 21 |
| Ciudad Autónoma de Buenos Aires, AR | 21 |
| Chapel Hill, US | 21 |
| Antiguo Cuscatlán, SV | 20 |
| Vancouver, CA | 20 |
| Austin, US | 20 |
| Paris, FR | 20 |
| Tuxtla Gutiérrez, MX | 20 |
| Puebla, MX | 20 |
| Severin-McDaniel Insect Collectionlocation not on record | 19 |
| Otaru, JP | 19 |
| Kawasaki Shi Tama Ku, JP | 19 |
| Taipei, TW | 19 |
| Miami, US | 19 |
| Wuhan, CN | 19 |
| Blumenau, BR | 19 |
| Nanjing, CN | 19 |
| Hiratsuka City Museumlocation not on record | 19 |
| Honolulu, US | 19 |
| Jyväskylä, FI | 19 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 19 |
| Universidad de Antioquia (UdeA)location not on record | 19 |
| Rotorua, NZ | 19 |
| Stockholm, SE | 18 |
| Acadia Universitylocation not on record | 18 |
| Philadelphia, US | 18 |
| Sagamihara, JP | 18 |
| GMBAlocation not on record | 18 |
| Xinxiang, CN | 18 |
| Yunnan Universitylocation not on record | 17 |
| Tsukuba, JP | 17 |
| Xiamen, CN | 17 |
| Arcata, US | 17 |
| Jaén, ES | 17 |
| Phyletisches Museum Jenalocation not on record | 17 |
| Université Lavallocation not on record | 17 |
| St. Paul, US | 17 |
| Saint John, CA | 17 |
| Fukushima Universitylocation not on record | 17 |
| La Paz, MX | 16 |
| Tlalnepantla, MX | 16 |
| Moscow, US | 16 |
| Montecillo, Texcoco, MX | 16 |
| Victoria, CA | 16 |
| Wuzhou, CN | 16 |
| Chadron, US | 15 |
| KR | 15 |
| John T. Waterhouse Herbariumlocation not on record | 15 |
| Urumqi, CN | 15 |
| UFBAlocation not on record | 14 |
| Tallinn, EE | 14 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 14 |
| Mexico City, MX | 14 |
| Culiacán, MX | 14 |
| Bangkok, TH | 14 |
| Mlocation not on record | 14 |
| Castelar, AR | 14 |
| Uniwersytet Śląski w Katowicachlocation not on record | 14 |
| Corrientes, AR | 13 |
| Albuquerque, US | 13 |
| KURAlocation not on record | 13 |
| Torreón, MX | 13 |
| Ensenada, MX | 13 |
| National Institute of Biological Resourceslocation not on record | 13 |
| JP | 13 |
| Salvador, BR | 13 |
| UGentlocation not on record | 13 |
| UTFPR-CPlocation not on record | 13 |
| SXTCMlocation not on record | 13 |
| Tuxtla Gutiérrez, MX | 13 |
| Mérida, MX | 13 |
| College Park, US | 13 |
| Denver, US | 12 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 12 |
| Zhengzhou, CN | 12 |
| Angwin, US | 12 |
| Frankfurt am Main | 12 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 12 |
| MeiseBGlocation not on record | 12 |
| Cambridge, US | 12 |
| Allentown, US | 12 |
| Laboratorio de Ictiologialocation not on record | 12 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 12 |
| Hunan Hupingshan National Nature Reservelocation not on record | 11 |
| Central China Normal Universitylocation not on record | 11 |
| Giardini Botanici Hanburylocation not on record | 11 |
| Laboratory of Palaeontologylocation not on record | 11 |
| Dekalb, US | 11 |
| Natural History Museum Rotterdamlocation not on record | 11 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 11 |
| Zapopan, MX | 11 |
| Kunming, CN | 11 |
| Istituto Agrario Castelnuovolocation not on record | 11 |
| UFMGlocation not on record | 11 |
| Nagatoro-machi, Chichibu-gun, JP | 11 |
| Green Bay, US | 11 |
| Osaka, JP | 11 |
| Kuopio, FI | 11 |
| Long Beach, US | 11 |
| Aarhus, DK | 10 |
| Turlock, US | 10 |
| Helsinki, FI | 10 |
| Pamplona, ES | 10 |
| Toronto, CA | 10 |
| US | 10 |
| Santa Cruz, US | 10 |
| UNIVASFlocation not on record | 10 |
| UNESClocation not on record | 10 |
| Brookings, US | 10 |
| Uppsala, SE | 9 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 9 |
| Nishihara, JP | 9 |
| GJOlocation not on record | 9 |
| Emporia, US | 9 |
| UFOPlocation not on record | 9 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 9 |
| Jackson, US | 9 |
| San José, CR | 9 |
| EEZA-CSIClocation not on record | 9 |
| Feira de Santana, BR | 9 |
| NSW Office of Environment and Heritagelocation not on record | 9 |
| Universidad de Caldas (UCaldas)location not on record | 9 |
| UEMlocation not on record | 9 |
| Departamento de Sistematica e Ecologialocation not on record | 8 |
| Chicago, US | 8 |
| Pelotas, BR | 8 |
| León, NI | 8 |
| Universidade Federale do Rio Grande do Sullocation not on record | 8 |
| KIRMlocation not on record | 8 |
| Autlán de Navarro, MX | 8 |
| Seoul, KR | 8 |
| Provo, US | 8 |
| Texas Lutheran Universitylocation not on record | 8 |
| Universidad Industrial de Santander (UIS)location not on record | 8 |
| Staten Island, US | 8 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 8 |
| Criciúma, BR | 8 |
| Shinshu Universitylocation not on record | 8 |
| Yaoundé, CM | 8 |
| GAlocation not on record | 8 |
| Missoula, US | 8 |
| Lubbock, US | 8 |
| Iwate Prefectural Museumlocation not on record | 8 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 8 |
| Universidad de La Salle (La Salle)location not on record | 7 |
| Loja, EC | 7 |
| Pocatello, US | 7 |
| Urumqi, CN | 7 |
| San Francisco, US | 7 |
| PRClocation not on record | 7 |
| Logan, US | 7 |
| J.F.Oberlin Universitylocation not on record | 7 |
| Zhejiang Universitylocation not on record | 7 |
| Awka, NG | 7 |
| Williamsburg, US | 7 |
| Campo Mourão, BR | 7 |
| Paleontological Collectionlocation not on record | 7 |
| Parkville, AU | 7 |
| GZUlocation not on record | 7 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 7 |
| KIWElocation not on record | 7 |
| Tacoma, US | 7 |
| Changsha, CN | 7 |
| BAYLUlocation not on record | 7 |
| Kushiro City Museumlocation not on record | 7 |
| QVMAGlocation not on record | 6 |
| Guatemala City, GT | 6 |
| Universidad Nacional Mayor de San Marcos, Museo de Historia Naturallocation not on record | 6 |
| FUNEDlocation not on record | 6 |
| Universidade Federal do Vale do São Franciscolocation not on record | 6 |
| Millersville, US | 6 |
| UnBlocation not on record | 6 |
| UNESP-FCAlocation not on record | 6 |
| Catalina Island Conservancylocation not on record | 6 |
| Herbarium of South China Botanical Gardenlocation not on record | 6 |
| Chicago, US | 6 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 6 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 6 |
| OLAlocation not on record | 6 |
| IDElocation not on record | 6 |
| James Cook Townsvillelocation not on record | 6 |
| INMAlocation not on record | 6 |
| New Brunswick, US | 6 |
| UNICAMPlocation not on record | 6 |
| Mississippi State, US | 6 |
| Wollongong, AU | 5 |
| Xian, CN | 5 |
| Porto Alegre, BR | 5 |
| Washington, US | 5 |
| Linares, MX | 5 |
| Jiujiang Forestry Institutelocation not on record | 5 |
| UTPLlocation not on record | 5 |
| Bourges, FR | 5 |
| Parthenon Tama History Museumlocation not on record | 5 |
| Chaguaramas, TT | 5 |
| Sendai, JP | 5 |
| Valparaíso, CL | 5 |
| Northridge, US | 5 |
| PUC-RSlocation not on record | 5 |
| Hermosillo, MX | 5 |
| IWEP FEB RASlocation not on record | 5 |
| Santa Teresa, BR | 5 |
| Durham, US | 5 |
| McWane Science Centerlocation not on record | 5 |
| DOI/NPS, Greenbelt Parklocation not on record | 5 |
| Viña del Mar, CL | 5 |
| Universidade Federal de Pelotaslocation not on record | 5 |
| DBF-NHMDlocation not on record | 5 |
| Bozeman, US | 5 |
| Smithfield, AU | 5 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 5 |
| Ural Federal University "B. N. Yeltsin"location not on record | 5 |
| MEXUlocation not on record | 5 |
| Altos de Pipe, VE | 5 |
| Brasília, BR | 5 |
| Knoxville, US | 5 |
| QCNElocation not on record | 5 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 5 |
| Frauenfeld, CH | 4 |
| Whitewater, US | 4 |
| Spearfish, US | 4 |
| University of Johannesburglocation not on record | 4 |
| Glarus, CH | 4 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 4 |
| Foz do Iguaçu, BR | 4 |
| IEBlocation not on record | 4 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 4 |
| Valdosta State Universitylocation not on record | 4 |
| San Angelo, US | 4 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 4 |
| Columbia, US | 4 |
| UFPRlocation not on record | 4 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 4 |
| Edinburgh, GB | 4 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 4 |
| University of Guelph, OAC Herbariumlocation not on record | 4 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 4 |
| Boise, US | 4 |
| Arizona State University Biocollectionslocation not on record | 4 |
| UNESP-RClocation not on record | 4 |
| Pondicherry, IN | 4 |
| Morelia, MX | 4 |
| CEPLAClocation not on record | 4 |
| Herbario de la Universidad Técnica del Nortelocation not on record | 4 |
| Zürich, CH | 4 |
| Clemson, US | 4 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 4 |
| UFMSlocation not on record | 4 |
| FUVATESlocation not on record | 4 |
| Obihiro Centennial City Museumlocation not on record | 4 |
| Ivano-Frankivsk, UA | 4 |
| GHPG$location not on record | 3 |
| Lake Charles, US | 3 |
| NMBU:MINAlocation not on record | 3 |
| San Bernardino, US | 3 |
| UDESC-CAVlocation not on record | 3 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 3 |
| Porrentruy, CH | 3 |
| Cuenca, EC | 3 |
| Akita Prefectural Museumlocation not on record | 3 |
| Davenport, US | 3 |
| Forssa, FI | 3 |
| Beijing, CN | 3 |
| UFPElocation not on record | 3 |
| UTFPR-DVlocation not on record | 3 |
| Chongqing Natural History Museumlocation not on record | 3 |
| Hangzhou, CN | 3 |
| La Trobe Universitylocation not on record | 3 |
| Minia, EG | 3 |
| Area de Conservacion Guanacastelocation not on record | 3 |
| PrivatHerblocation not on record | 3 |
| Whitehorse, CA | 3 |
| Fulda, DE | 3 |
| Inner Mongolia Universitylocation not on record | 3 |
| Plocation not on record | 3 |
| Mérida, MX | 3 |
| Guiyang, CN | 3 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 3 |
| Shenzhen, CN | 3 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 3 |
| Cenargenlocation not on record | 3 |
| LfUlocation not on record | 3 |
| Palmerston North, NZ | 3 |
| JBRJlocation not on record | 3 |
| Tepatitlán de Morelos, MX | 3 |
| Mount Berry, US | 3 |
| National Museum Waleslocation not on record | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| Santa Cruz de la Sierra, BO | 3 |
| SZUlocation not on record | 3 |
| Guilin, CN | 3 |
| Quito, EC | 3 |
| GB | 3 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 3 |
| Garðabær, IS | 3 |
| Arequipa, PE | 3 |
| Cambridge, US | 3 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 3 |
| Fredericksburg, US | 3 |
| UNESP, Campus São José Rio Prêtolocation not on record | 2 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 2 |
| EMTCMlocation not on record | 2 |
| UTFPR-SLlocation not on record | 2 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| UESBlocation not on record | 2 |
| Keene State Universitylocation not on record | 2 |
| Banyoles, ES | 2 |
| Caldwell, US | 2 |
| Federal University of Espírito Santolocation not on record | 2 |
| Batemans Bay, AU | 2 |
| BGPAlocation not on record | 2 |
| Toyota city nature sanctuarylocation not on record | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Hanshan Normal Universitylocation not on record | 2 |
| Little Rock, US | 2 |
| Tuscaloosa, US | 2 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 2 |
| Zürich, CH | 2 |
| Elocation not on record | 2 |
| BSBIlocation not on record | 2 |
| Jishou Universitylocation not on record | 2 |
| Arizona Western Collegelocation not on record | 2 |
| ENTClocation not on record | 2 |
| Dresden, DE | 2 |
| University of Southern Mississippilocation not on record | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| HUAlocation not on record | 2 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 2 |
| IAPlocation not on record | 2 |
| KOMlocation not on record | 2 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 2 |
| Stephenville, US | 2 |
| Campo Grande, BR | 2 |
| Universidad de Nariño (UdeNar)location not on record | 2 |
| Korea National Arboretumlocation not on record | 2 |
| Sion, CH | 2 |
| Joondalup, AU | 2 |
| Tilburg, NL | 2 |
| National Museums of Kenyalocation not on record | 2 |
| UFESlocation not on record | 2 |
| JBSlocation not on record | 2 |
| BMlocation not on record | 2 |
| Jiangxi College of Educationlocation not on record | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| Universidade Tecnológica Federal do Paranálocation not on record | 2 |
| TAFORI-LSRClocation not on record | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| Shanxi Institute of Biologylocation not on record | 2 |
| Brasília, BR | 2 |
| Taiyuan Normal Universitylocation not on record | 2 |
| Montréal, CA | 2 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Musée des Confluenceslocation not on record | 2 |
| Ilhéus, BR | 2 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 2 |
| USP-IBlocation not on record | 2 |
| Orto botanico dell'Università degli Studi di Catanialocation not on record | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Anchorage, US | 2 |
| Pittsburg, US | 2 |
| Baroda, IN | 2 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 2 |
| Universidad Nacional de Asunciónlocation not on record | 2 |
| Museo civico di Ecologia e Storia naturale di Marano sul Panarolocation not on record | 2 |
| The University of Arizonalocation not on record | 2 |
| Gujarat Biodiversity Gene Banklocation not on record | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| CIBIOlocation not on record | 2 |
| SWlocation not on record | 2 |
| KNAMlocation not on record | 2 |
| La Paz, BO | 2 |
| Chapingo, MX | 2 |
| US | 1 |
| Sucre, BO | 1 |
| Glocation not on record | 1 |
| Sapporo, JP | 1 |
| Universidad Nacional Agrarialocation not on record | 1 |
| Guatemala, GT | 1 |
| Coimbra, PT | 1 |
| Santiago de Cali, CO | 1 |
| Oiso Municipal Museumlocation not on record | 1 |
| San Luis Potosí, MX | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| WINlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| San Francisco, US | 1 |
| Kandalaksha State Nature Reservelocation not on record | 1 |
| Calabar, NG | 1 |
| Henderson, US | 1 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 1 |
| Western Carolina Universitylocation not on record | 1 |
| DULlocation not on record | 1 |
| Ciudad de México, MX | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Philadelphia, US | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| H-Dunkellocation not on record | 1 |
| Hamilton, US | 1 |
| UERJlocation not on record | 1 |
| Masindi, UG | 1 |
| CUVClocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| ESP003location not on record | 1 |
| FPMZBlocation not on record | 1 |
| Arusha, TZ | 1 |
| arosemena tola, EC | 1 |
| PUC-RIOlocation not on record | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| UFSJlocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Hudson, US | 1 |
| WAGlocation not on record | 1 |
| DASSHlocation not on record | 1 |
| Monastir, TN | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| University of Patraslocation not on record | 1 |
| UFRRJlocation not on record | 1 |
| San Francisco de Campeche, MX | 1 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 1 |
| Cusco, PE | 1 |
| Cuiabá, BR | 1 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 1 |
| Shanghai, CN | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Chicago, US | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| Gijón, ES | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| Nijmegen, NL | 1 |
| Maringá, BR | 1 |
| Riobamba, EC | 1 |
| Portland, US | 1 |
| Museo Athanasius Kircher di Romalocation not on record | 1 |
| ESP026location not on record | 1 |
| Cenit Transporte y Logística de Hidrocarburos S.A.S. (CENIT)location not on record | 1 |
| Seropédica, BR | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| Namur, BE | 1 |
| Ashland, US | 1 |
| Portland, US | 1 |
| ESP027location not on record | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| QAPlocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| San Jose, US | 1 |
| University of Zhejianglocation not on record | 1 |
| Sangmiung Universitylocation not on record | 1 |
| ESP004location not on record | 1 |
| Shanghai, CN | 1 |
| Uberlândia, BR | 1 |
| Herbier National du Gabonlocation not on record | 1 |
| Orem, US | 1 |
| Columbus State Universitylocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Universidad Autónoma de Nayaritlocation not on record | 1 |
| Valparaiso, CL | 1 |
| Göteborg, SE | 1 |
| SIHUlocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Cheney, US | 1 |
| MMHNSRlocation not on record | 1 |
| Ciudad de México, MX | 1 |
| CNF-UFHBlocation not on record | 1 |
| Walla Walla, US | 1 |
| Moscow University Herbarium (MW)location not on record | 1 |
| Guangzhou, CN | 1 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Umeå Universitylocation not on record | 1 |
| Nanchong, CN | 1 |
| Jinghong, CN | 1 |
| Shanxi Universitylocation not on record | 1 |
| Jardín Botánico de Bogotá "José Celestino Mutis" (JBB)location not on record | 1 |
| Cascavel, BR | 1 |
| Universidade do Estado de Santa Catarinalocation not on record | 1 |
| OTSlocation not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| UFRPElocation not on record | 1 |
| Fort Bragg, US | 1 |
| UNEMATlocation not on record | 1 |
| Jataí / Setor Industrial, BR | 1 |
| nbflocation not on record | 1 |
| Toluca, MX | 1 |
| Zhuzhou, CN | 1 |
| National Marine Biodiversity Institute of Korealocation not on record | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| Universidade de São Paulolocation not on record | 1 |
| Rishon Le Zion, IL | 1 |
| Lincoln, US | 1 |
| Herb. BBGlocation not on record | 1 |
| MX | 1 |
648 institutions · 18 718 of 20 085 vouchered records shown · 1 151 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA68 detections
Where the DNA of Sonchus oleraceus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found68
Studies independent surveys2
Countries16
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 68 detections have coordinates
Open the map16 countries0
GardenChaparral with Xylococcus bicolor, Ceanothus…in ruderal habitat next to road verge
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.8 °C 10.9–21.9
Seasonal swing summer↔winter14.9 °C
Max temp (day)20.3 °C 15.2–29.4
Min temp (night)11.7 °C 4.20–17.3
Precipitation46.6 mm/mo 2.30–112
Air humidity58.0 % 48.6–67.8
Moisture balance-55.5 mm/mo -133–73.9
Vapour deficit700 Pa 538–1,379
Wind speed3.00 m/s 2.10–4.80
Cloud cover43.3 % 20.2–56.8
CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.