Sonchus micranthus

(Bertero ex DC.) S.C.Kim & Mejías · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Sonchus

At a glance

Occurrence records0

Data sources8

Biological traits9

DNA specimens0

eDNA detections3

Sources8 archives

Databases and archives Sonchus micranthus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Chemical compositionLOTUS14 compounds

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Dendroseris micrantha is a species of flowering plant in the family Asteraceae. It is found only in the Juan Fernández Islands of Chile. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: shrub/tree

Woodinesswoody

03Chemical composition14 compounds

Compounds documented for Sonchus micranthus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Polyamines5

Simple amide alkaloids1

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-2-[3-(3-bromo-4-methoxyphenyl)prop-2-enoylamino]-5-(diaminomethylideneamino)pentanoic acid	present	LOTUS
(2R)-5-(diaminomethylideneamino)-2-[3-(3,5-dibromo-4-methoxyphenyl)prop-2-enoylamino]pentanoic acid	present	LOTUS
1-Oxa-2-azaspiro(4.5)deca-2,6,8-triene-3-carboxamide, N,N'-1,4-butanediylbis(7,9-dibromo-10-hydroxy-8-methoxy-	present	LOTUS
2,4-Cyclohexadiene-1-acetonitrile, 3,5-dibromo-1,6-dihydroxy-4-methoxy-, (1S-trans)-	present	LOTUS
5,7-Dibromo-3a,7a-dihydro-3a-hydroxy-6-methoxy-2(3H)-benzofuranone	present	LOTUS
7,9-dibromo-N-[3-[2,6-dibromo-4-[2-[(7,9-dibromo-6-hydroxy-8-methoxy-1-oxa-2-azaspiro[4.5]deca-2,7,9-triene-3-carbonyl)amino]ethyl]phenoxy]propyl]-6-hydroxy-8-methoxy-1-oxa-2-azaspiro[4.5]deca-2,7,9-triene-3-carboxamide	present	LOTUS
7,9-dibromo-N-[4-(diaminomethylideneamino)butyl]-6-hydroxy-8-methoxy-1-oxa-2-azaspiro[4.5]deca-2,7,9-triene-3-carboxamide	present	LOTUS
Dichloroverongiaquinol	present	LOTUS
ethyl N-[4-[(7,9-dibromo-6-hydroxy-8-methoxy-1-oxa-2-azaspiro[4.5]deca-2,7,9-triene-3-carbonyl)amino]butyl]carbamate	present	LOTUS
ethyl N-[5-[(7,9-dibromo-6-hydroxy-8-methoxy-1-oxa-2-azaspiro[4.5]deca-2,7,9-triene-3-carbonyl)amino]pentyl]carbamate	present	LOTUS

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sonchus micranthus has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences6

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKY047631.1 ↗1 242 bp

ACGT

ACTTATTATACTCCTGACTATGAAACCAAGGATACTGATATTTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAA …

Sonchus micranthus ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Sonchus micranthus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome records36–362n range36median36mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 362×CCDB · chile · CCDB · kew

CCDB · chile — SANDERS, R., T. STUESSY & R. RODRIGUEZ. 1983. Chromosome numbers from the flora of the Juan Fernandez Islands. American Journal of Botany 70: 799-810

CCDB · kew — Lack HW, Sack G, Bachmann K. 1978. The genome of Dendroseris litoralis, and arboreal insular endemic of the tribe Lactucaeae (Asteraceae). Beitr. Biol. Pfl. 54: 425-441.

n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sanders, R. W., T. F. Stuessy & R. Rodriguez. 1983. Chromosome numbers from the flora of the Juan Fernandez Islands. Amer. J. Bot. 70: 799–810.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

09Environmental DNA3 detections

Where the DNA of Sonchus micranthus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 14.1–14.1

Seasonal swing summer↔winter12.4 °C

Max temp (day)20.5 °C

Min temp (night)8.70 °C

Precipitation145 mm/mo

Air humidity58.8 %

Moisture balance39.0 mm/mo

Vapour deficit702 Pa

Wind speed2.50 m/s

Cloud cover20.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)