Sonchus congestus

Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Sonchus

At a glance

Occurrence records618

Data sources10

Biological traits30

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Sonchus congestus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility618 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources30 traits

Chemical compositionLOTUS9 compounds

Occurrence & distributionGBIF618 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Sonchus congestus is a species of flowering plant in the family Asteraceae. It is endemic to the Canary Islands (Gran Canaria and Tenerife).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology11

Fruit length max3 mm

Fruit length min2.5 mm

Fruit width max1.25 mm

Fruit width min0.85 mm

Leaf length max450 mm

Leaf length min100 mm

Leaf width max120 mm

Leaf width min30 mm

Plant height0.8 m

Plant height max2 m

Plant height min0.4 m

Life cycle & reproduction10

Dehiscenceindehiscent

Flower colouryellow

Flower length max30 mm

Flower length min25 mm

Flower width max60 mm

Flower width min35 mm

Flowering endJul

Flowering startFeb

Life spanannual

⚠ sources differ — TRY: annual · GIFT: perennial

Lifespan years5 years

Habitat & environment8

Climatesubtropical

Elevation max800 m

Elevation min150 m

Fruit colourblack

Fruit typeachene

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: herb

Leaf formpinnatifid

Woodinessnon-woody

Other traits1

Leaf arrangementrosette

03Chemical composition9 compounds

Compounds documented for Sonchus congestus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavones6

Simple coumarins2

Guaiane sesquiterpenoids1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(3R,4R,6S)-6-[[(2R,3S,4S,5R,6S)-6-[2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxochromen-7-yl]oxy-3,4,5-trihydroxyoxan-2-yl]methoxy]-3,4,5-trihydroxyoxane-2-carboxylic acid	present	LOTUS
(3S,4S,6S)-3,4,5-trihydroxy-6-[5-hydroxy-2-(4-hydroxyphenyl)-4-oxochromen-7-yl]oxyoxane-2-carboxylic acid	present	LOTUS
Aesculetin	present	LOTUS
Apiumetrin	present	LOTUS
Jacquinelin	present	LOTUS
Luteolin 7-glucoside	present	LOTUS
Luteolin 7-glucuronide	present	LOTUS
Luteolin rutinoside	present	LOTUS
Scopoletin	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sonchus congestus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSL48176.1 ↗219 bp

ACGT

ATCGCTCGCCCCCCGCCAAACATCCCCAAAGGTAATCATGGTGATGGGGGCGGAAATTGGCCTTCCCGTTCATGTGTCTGGTTGGCCTAA …

Sonchus congestus Willd. (Gran Canaria population) internal transcribed spacer 2 (ITS2) DNA

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Sonchus congestus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 184×CCDB · book-ipcn72 · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +1

CCDB · book-ipcn72 — BRAMWELL, D., C.J. HUMPHRIES, B.G. MURRAY, & S.J. OWENS. 1972. Chromosome studies in the flora of Macaronesia. Bot. Notiser 125: 139-152.

CCDB · book-ipcn67-71 — BORGEN L. 1970. Chromosome numbers of Macaronesian flowering plants. Nytt Mag. Bot. 17: 145-161.

CCDB · book-ipcn73-74 — VAN LOON, J. 1974. A cytological investigation of flowering plants from the Canary islands. Acta Bot. Neerl. 23: 113-124.

CCDB · kew — Suda J, Kyncl T, Freiova R. 2003. Nuclear DNA amounts in Macaronesian angiosperms. Annals of Botany 92: 153-164.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type618 records

Wild obs. + sensor600

Museum / vouchered17

Cultivated / captive1

Range

Area of Occupancy AOO712 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy45% within 1 km

≤100 m 179≤1 km 58≤10 km 242>10 km 42

521 georeferenced · 79 without coordinates

Open the mapobservation + sensor600

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 1≤1 km 1≤10 km 6

8 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence17

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	5
Paris, FR	2
LDlocation not on record	2
Xiamen, CN	1
GJOlocation not on record	1
València, ES	1
College of the Atlantic, Museumlocation not on record	1
Uppsala, SE	1

8 institutions · 14 of 17 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Sonchus congestus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)