Sonchus canariensis

(Webb) Boulos · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Sonchus

At a glance

Occurrence records455

Data sources11

Biological traits29

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Sonchus canariensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility455 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources29 traits

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF455 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT1.4 Gbp

01Narrative

Sonchus canariensis, the tree sonchus, is a species of plant endemic to the Canary Islands.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology11

Fruit length max3.2 mm

Fruit length min3 mm

Fruit width max1.1 mm

Fruit width min0.8 mm

Leaf length max400 mm

Leaf length min100 mm

Leaf width max120 mm

Leaf width min60 mm

Plant height0.8 m

Plant height max3 m

Plant height min1.5 m

Life cycle & reproduction10

Dehiscenceindehiscent

Flower colouryellow

Flower length max15 mm

Flower length min12 mm

Flower width max30 mm

Flower width min25 mm

Flowering endMay

Flowering startFeb

Life spanperennial

Lifespan years11 years

Habitat & environment7

Elevation max800 m

Elevation min200 m

Fruit colourbrown

Fruit typeachene

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: e N

Leaf formlinear

Woodinessnon-woody

Other traits1

Leaf arrangementrosette

03Chemical composition6 compounds

Compounds documented for Sonchus canariensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavones4

Simple coumarins2

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
Aesculetin	present	LOTUS
Apiumetrin	present	LOTUS
Luteolin 7-glucoside	present	LOTUS
Luteolin 7-glucuronide	present	LOTUS
Luteolin rutinoside	present	LOTUS
Scopoletin	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sonchus canariensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSL48324.1 ↗221 bp

ACGT

ATCGCTCGCCCCCCGCCAAACATCCCCAAAGGTAATCATGGTGATGGGGGCGGAAATTGGCCTCCCGTTCTTGTGTCTGGTTGGCCTAAA …

Taeckholmia canariensis Boulos internal transcribed spacer 2 (ITS2) DNA

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Sonchus canariensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 413 210 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sonchus canariensis1.41 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 183×GoaT · Kew Plant DNA C-values Database · CCDB · book-ipcn67-71 · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-ipcn67-71 — BORGEN, L. 1969. Chromosome numbers of vascular plants from the Canary Islands, with special reference to the occurence of polyploidy. Nytt Magasin for Botanik 16: 18-121.

CCDB · kew — Suda J, Kyncl T, Jarolimova V. 2005. Genome size variation in Macaronesian angiosperms: forty percent of the Canarian endemic flora completed. Plant Systematics and Evolution 252: 215-238.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type455 records

Wild obs. + sensor445

Museum / vouchered9

Cultivated / captive1

Range

Area of Occupancy AOO660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 235≤1 km 55≤10 km 61>10 km 10

361 georeferenced · 84 without coordinates

Open the mapobservation + sensor445

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence9

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	6
Xiamen, CN	2
Barcelona, ES	1

3 institutions · 9 of 9 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Sonchus canariensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)