Sonchus brassicifolius

S.C.Kim & Mejías · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Sonchus

At a glance

Occurrence records0

Data sources7

Biological traits12

DNA specimens0

eDNA detections3

Sources7 archives

Databases and archives Sonchus brassicifolius's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources12 traits

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Single capitulum (one of many) of specimen flowering in Kew Gardens. Dendroseris litoralis, the cabbage tree, is a small evergreen tree species belonging to the daisy and sunflower family Asteraceae. It is found only on the Juan Fernández Islands, west of Chile, and is threatened by habitat loss. It is native only to tiny, volcanic Robinson Crusoe Island, one of the Juan Fernández Islands in the southeast Pacific, far off the coast of Chile, and home of the famed Juania australis and many other endemic plants. This strange, small tree has been brought back from the brink of extinction. It had been reduced to only a few individuals by feral goats on the island, and is still considered critically endangered.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology3

Seed mass5.77 mg

Seed mass max6.54 mg

Seed mass min5.23 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: herb/tree

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: woody

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sonchus brassicifolius has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences5

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAJ633305.1 ↗608 bpChile

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAAATACAACTCGGTGCTGTTGAGATGGGCCTTAGGTTCTTATCAGCAACACCAT …

Dendroseris litoralis 5.8S rRNA gene, ITS1 and ITS2, specimen voucher GAT-bg74

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Sonchus brassicifolius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome records36–362n range36median36mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 364×CCDB · ipcn-api-dl · CCDB · chile · CCDB · kew

CCDB · ipcn-api-dl — Tomb, A. S., K. L. Chambers, D. W. KYHOS, A. M. Powell & P. H. RAVEN. 1978. Chromosome numbers in the Compositae XIV. Lactuceae. Amer. J. Bot. 65: 717–721.

CCDB · ipcn-api-dl — Baeza, C. M. 2004. Recuentos cromosómicos en plantas que crecen en Chile. II. Darwiniana 42(1–4): 25–29.

CCDB · chile — BAEZA, C., M. VOSYKA & T. STUESSY. 2004. Recuentos cromosomicos en plantas que crecen en Chile. II. Darwiniana 42(1-2): 25-29.

CCDB · kew — Lack HW, Sack G, Bachmann K. 1978. The genome of Dendroseris litoralis, and arboreal insular endemic of the tribe Lactucaeae (Asteraceae). Beitr. Biol. Pfl. 54: 425-441.

n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sanders, R. W., T. F. Stuessy & R. Rodriguez. 1983. Chromosome numbers from the flora of the Juan Fernandez Islands. Amer. J. Bot. 70: 799–810.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

09Environmental DNA3 detections

Where the DNA of Sonchus brassicifolius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 14.1–14.1

Seasonal swing summer↔winter12.4 °C

Max temp (day)20.5 °C

Min temp (night)8.70 °C

Precipitation145 mm/mo

Air humidity58.8 %

Moisture balance39.0 mm/mo

Vapour deficit702 Pa

Wind speed2.50 m/s

Cloud cover20.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)