Sonchus asper
(L.) Hill · speciesAt a glance
Occurrence records507 977
Data sources14
Biological traits80
DNA specimens96
eDNA detections69
Sources14 archives
Databases and archives Sonchus asper's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility507 977 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI69 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics96 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources80 traits
Chemical compositionLOTUS · NPASS71 compounds
Occurrence & distributionGBIF507 977 records
Environmental DNA2 datasets · 17 countries69 detections
DNA & barcodingBOLD · NCBI96 specimens
Genome at a glanceCCDB · GIFT · GoaT802 Mbp
01Narrative
Sonchus asper, le Laiteron piquant ou Laiteron rude, est une espèce de plantes à fleurs de la famille des Astéracées. Il est assez proche du Sonchus oleraceus, qui contrairement au Sonchus asper, ne possède pas de feuille embrassant la tige par deux oreillettes larges, spiraloïdes. C’est une espèce ayant une très large distribution. Si à sa distribution d’origine, on rajoute les régions où elle a été introduite et où elle s’est naturalisée, elle est quasi-cosmopolite. Elle colonise les milieux anthropisés tels que les champs cultivés, les friches, les jardins et même les trottoirs de Paris.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology28
Fruit length2.5 mm
⚠ sources differ — AusTraits: 2.5 mm · GIFT: 3 mm
Fruit length max3 mm
Fruit length min0.25 mm
Fruit width1.3 mm
⚠ sources differ — AusTraits: 1.3 mm · GIFT: 0.55 mm
Leaf length200 mm
Leaf length max250 mm
Leaf length min40 mm
Leaf mass231 mg
Leaf size562 mm²
⚠ sources differ — TRY: 562 mm² · LEDA: 6 070 mm² · GIFT: 5 417 mm²
Leaf width45 mm
Leaf width max80 mm
Leaf width min20 mm
Plant height0.458 m
⚠ sources differ — GIFT: 0.458 m · AusTraits: 1.35 m · LEDA: 0.475 m · TRY: 0.38 m
Plant height generative0.79 m
Plant height max2 m
Plant height min0.07 m
Seed length2.0 mm
⚠ sources differ — TRY: 2.0 mm · GIFT: 2.7 mm
Seed length max2.7 mm
Seed length min2.7 mm
Seed mass0.28 mg
Seed mass max0.414 mg
Seed mass min0.17 mg
Seed volume1.6 mm³
Seed volume max1.6 mm³
Seed volume min1.6 mm³
Seed width1.3 mm
Seed width max1.3 mm
Seed width min1.3 mm
Life cycle & reproduction21
Deciduousnesssemi-evergreen
⚠ sources differ — TRY: semi-evergreen · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typewind
⚠ sources differ — AusTraits: anemochory · LEDA: endozoochor · GIFT: anemochorous
Flower colouryellow
Flower width max25 mm
Flower width min20 mm
Flowering endDec
Flowering startJun
Flowering timennnnnnnnnyyy
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Reproductive maturity1 years
Resprouting capacityfire_killed
Seed number5 800
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max4 100 m
Elevation mean2 550 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTÁrea Antrópica
Leaf compoundnesssimple
Leaf formpinnatifid
Leaf shapelanceolate oblanceolate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio27.29 g/g
Leaf c412 mg/g
Leaf dry-matter content (LDMC)106 mg/g
⚠ sources differ — TRY: 106 mg/g · LEDA: 124 mg/g
Leaf n17 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)37.44 mm²/mg
⚠ sources differ — TRY: 37.44 mm²/mg · LEDA: 22.07 mm²/mg · GIFT: 24.97 mm²/mg
Other traits5
Defenseyes
Diaspore typeone-seeded generative dispersule
Inflorescenceraceme
Leaf arrangementalternate
Seeds per fruit>1000
03Chemical composition71 compounds
Compounds documented for Sonchus asper across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Eudesmane sesquiterpenoids18
Germacrane sesquiterpenoids17
Ursane and Taraxastane triterpenoids8
Hydrocarbons7
Flavones7
Documented compounds71 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (3aR,4S,6E,10E,11aS)-4-hydroxy-3-methylidene-2-oxo-10-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-6-carbaldehyde | present | LOTUS | |
| (3aR,4S,6E,10Z,11aR)-4-hydroxy-3-methylidene-2-oxo-10-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-6-carbaldehyde | present | LOTUS | |
| (3aS,5aR,6R,9aS,9bS)-5a-methyl-3,9-dimethylidene-6-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,6,7,8,9a,9b-octahydrobenzo[g][1]benzofuran-2-one | present | LOTUS | |
| (3aS,5aR,6R,9R,9aS,9bS)-5a-methyl-3-methylidene-2-oxo-6-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4,5,6,7,8,9,9a,9b-octahydro-3aH-benzo[g][1]benzofuran-9-carbaldehyde | present | LOTUS | |
| (3aS,5aR,6R,9R,9aS,9bS)-5a-methyl-3-methylidene-2-oxo-6-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4,5,6,7,8,9,9a,9b-octahydro-3aH-benzo[g][1]benzofuran-9-carbaldehyde | present | LOTUS | |
| (3aS,5aR,6R,9R,9aS,9bS)-9-(hydroxymethyl)-5a-methyl-3-methylidene-6-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4,5,6,7,8,9,9a,9b-octahydro-3aH-benzo[g][1]benzofuran-2-one | present | LOTUS | |
| (3aS,5aR,6R,9R,9aS,9bS)-9-(hydroxymethyl)-5a-methyl-3-methylidene-6-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4,5,6,7,8,9,9a,9b-octahydro-3aH-benzo[g][1]benzofuran-2-one | present | LOTUS | |
| (3R,4R,6S)-6-[[(2R,3S,4S,5R,6S)-6-[2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxochromen-7-yl]oxy-3,4,5-trihydroxyoxan-2-yl]methoxy]-3,4,5-trihydroxyoxane-2-carboxylic acid | present | LOTUS | |
| (3S,3aR,4S,6E,10E,11aR)-4-hydroxy-10-(hydroxymethyl)-3-methyl-2-oxo-3a,4,5,8,9,11a-hexahydro-3H-cyclodeca[b]furan-6-carbaldehyde | present | LOTUS | |
| (3S,3aR,4S,6E,10Z,11aR)-4-hydroxy-10-(hydroxymethyl)-3-methyl-2-oxo-3a,4,5,8,9,11a-hexahydro-3H-cyclodeca[b]furan-6-carbaldehyde | present | LOTUS |
05DNA & barcoding96 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sonchus asper has left across the world's sequence archives.
At a glance
DNA specimens96
Marker genes9
GenBank sequences10
eDNA detections69
Countries17
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATC …
Sonchus asper voucher EDNA21-0061441 internal transcribed spacer region, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL★rbcLa★trnL-F★ITS10★ITS1★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Sonchus asper carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size801 960 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Sonchus asper0.80 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records16–642n range32median18mode267records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 18125×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +22
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — MARCHI P. - 1971. Numeri cromosomici per la flora italiana:57-66.. Inform. Bot. Ital. , 3(2): 124-137.
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Šimková Ľ., 2007: [New records in Carum, Chelidonium, Epilobium, Lathyrus, Linaria, Lychnis, Picris, Primula, Scorzoneroides, Sonchus, Vicia, and Viola], pp. 178, 189, 239, 358, 371, 380, 437, 469, 531, 554, 614, 616, 617, 620. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · iapt
CCDB · brit-fl — Edmonds, J.M., Sell, P.D., Walters, S.M. Watsonia 10: 159-161 (1974)
CCDB · brit-fl — Edmonds, J.M., Sell, P.D., Walters, S.M. (1973)
CCDB · brit-fl — Jones, K. (1969)
CCDB · brit-fl — Rutland, J.P. New Phytol. 40: 210-214 (1941)
CCDB · brit-fl — Barber, H.N. Ann. Bot. (London), n.s. 5: 375-377 (1941)
CCDB · brit-fl — Curran, P.L. Irish Naturalists' J. 16: 7-9 (1968)
CCDB · iber-fl — Palynological and cytological observations in Spanish Sonchus (Asteraceae). Mejas, J. A. & M. J. Dez.Grana32: 343-347(1993).
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3910
CCDB · fl-europaea — Gadella & Kliphuis,
CCDB · poland — Walter R. and Kuta E. 1971. Cytological and embryological studies in Sonchus L. I. Sonchus asper (L.) Hill, and Sonchus oleraceus L. Acta Biol. Cracov. Ser. Bot. 14, 103-109.
CCDB · book-ipcn65 — Larsen 1965b
CCDB · book-ipcn65 — Boulos 1965
CCDB · ipcn-api-dl — Renard, R., J. Lambinon, M. Reekmans, P. v. Veken & M. Govaert. 1983. Nombres chromosomiques de quelques Angiospermes du Rwanda, du Burundi et du Kenya. Bull. Jard. Bot. Nat. Belg. 53: 342–371.
CCDB · ipcn-api-dl — Morton, J. K. 1993. Chromosome numbers and polyploidy in the flora of Cameroon Mountain. Opera Bot. 121: 159–172.
CCDB · ipcn-api-dl — Kirschner, J., J. Stepanek & J. Stepankova. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 574–575.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1981. Kariologicheskoe issledovanie sosudistykh rastenij ostrovov Dal'nevostocnogo gosudarstvennogo morskogo sapovednika. Sb. Cvetkaye Rastenija Ostrovov Dalnevostochnogo Morskogo Sapovednika. 92–114.
CCDB · ipcn-api-dl — Nazarova, E. A. 1984. Chromosome numbers in the Caucasian representatives of the families Asteraceae, Brassicaceae, Fabaceae, Limoniaceae. Bot. Zhurn. SSSR 69(7): 972–975. (In Russian).
CCDB · ipcn-api-dl — Nazarova, E. A. 1989. Karyological and palynological study of representatives of the genus Sonchus from the Caucasus. Bot. Žhurn. (Moscow & Leningrad) 74: 53–59.
CCDB · ipcn-api-dl — Nishikawa, T. 1984. Chromosome counts of flowering plants of Hokkaido (7). J. Hokkaido Univ. Educ., Sect. 2B 35: 31–42.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — Prabha, C. 1988. A report of accessory chromosomes in two diploid species of Sonchus L. Cell Chromosome Res. 11: 28–29.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek, E. Hellmayr, J. Walter, J. Tschenett, C. Justin & M. Mann. 1991. Beiträge zur Flora von Österreich: Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 128: 19–39.
CCDB · ipcn-api-dl — Vogt, R. & C. Oberprieler. 1993. Chromosome numbers of north African phanerograms. I. Fl. Medit. 3: 187–210.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Sidhu, M. K. 1979. Distributional and cytological studies of the weed flora of cultivable fields of Patiala district (Panjab). Ph.D. Thesis, Patiala. 1-230. 1979.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1980. Cyto-palynological studies on weed flora of cultivable lands of Patiala district (Punjab). J. Palynol. 16: 85–105.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Van Den Brand, C., F. C. M. V. Meel & J. H. Wieffering. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 395–397.
CCDB · ipcn-api-dl — Fernandez Casas, J., A. P. Sorolla & A. Susanna. 1980a. Numeros cromosomaticos de plantas occidentales, 48-54. Anales Jard. Bot. Madrid 36: 401–405.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1979. Cytological observations in weed fiora of orchards of Paticla district, Punjab. Recent Res. Pl. Sci. (New Delhi). 7: 261–271.
+76 more references
2n 32124×CCDB · slov-fl · CCDB · brit-fl · CCDB · iber-fl +14
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · slov-fl — Leskovjanská A., 2007: [New records in Cirsium, Eupatorium, Lapsana, Leontodon, Medicago, Melilotus, Plantago, Salvia, Senecio, Silene, Sonchus, Tanacetum, Thlaspi, Trifolium, and Veronica], pp. 195, 251, 355, 359, 384, 387, 453, 518, 536, 549, 555, 568, 582, 592, 603. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · brit-fl — Edmonds, J.M., Sell, P.D., Walters, S.M. Watsonia 10: 159-161 (1974)
CCDB · brit-fl — Rutland, J.P. New Phytol. 40: 210-214 (1941)
CCDB · brit-fl — Curran, P.L. Irish Naturalists' J. 16: 7-9 (1968)
CCDB · brit-fl — Al-Bermani, A.-K.K.A., Al-Shammary, K.I.A., Bailey, J.P., Gornall, R.J. Watsonia 19: 269-271 (1993)
CCDB · brit-fl — Barber, H.N. Ann. Bot. (London), n.s. 5: 375-377 (1941)
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 169-175. Pajarn Sotomayor, S.Anales Jard. Bot. Madrid38(2): 519-522(1982).
CCDB · iber-fl — Palynological and cytological observations in Spanish Sonchus (Asteraceae). Mejas, J. A. & M. J. Dez.Grana32: 343-347(1993).
CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3909
CCDB · fl-europaea — Rodriguez, 1953
CCDB · ipcn-api-dl — Nirmala, A. & P. N. Rao. 1984. Karyotype studies in Asteraceae. Cell Chromosome Res. 7: 26–28.
CCDB · ipcn-api-dl — Nirmala, A. & P. N. Rao. 1989. Karyotype studies in some Asteraceae. Cell Chromosome Res. 12: 17–18.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Nazarova, E. A. 1984. Chromosome numbers in the Caucasian representatives of the families Asteraceae, Brassicaceae, Fabaceae, Limoniaceae. Bot. Zhurn. SSSR 69(7): 972–975. (In Russian).
CCDB · ipcn-api-dl — Guerra, M. d. S. 1986. Citogenetica de Angiospermas coletadas en Pernambuco, I. Revista Brasil. Genét. 9: 21–40.
CCDB · ipcn-api-dl — Nazarova, E. A. 1989. Karyological and palynological study of representatives of the genus Sonchus from the Caucasus. Bot. Žhurn. (Moscow & Leningrad) 74: 53–59.
CCDB · ipcn-api-dl — Nishikawa, T. 1984. Chromosome counts of flowering plants of Hokkaido (7). J. Hokkaido Univ. Educ., Sect. 2B 35: 31–42.
CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — Pangua, E., C. Prada, S. Pajaron & E. Salvo. 1992. A new Asplenium hybrid from Valencia (Spain) related to A. majoricum Litard. Bot. J. Linn. Soc. 108(1): 1–13.
CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1991. Chromosome numbers in some plant species from the south-west of the Komi ASSR. Bot. Žhurn. (Moscow & Leningrad) 76: 769–771.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek, E. Hellmayr, J. Walter, J. Tschenett, C. Justin & M. Mann. 1991. Beiträge zur Flora von Österreich: Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 128: 19–39.
CCDB · ipcn-api-dl — Al-Bermani, A. K. K. A., K. I. A. Al-Shammary, R. J. Gornall & J. P. Bailey. 1993. Contribution to a cytological catalogue of the British and Irish flora, 3. Watsonia 19: 169–171.
CCDB · ipcn-api-dl — Xu, B. s., R. f. Weng & M. z. Zhang. 1992. Chromosome numbers of Shanghai plants I. Invest. Stud. Nat. 12: 48–65.
CCDB · ipcn-api-dl — Díaz Lifante, Z., T. Luque & C. S. Bárbara. 1992. Chromosome numbers of plants collected during Iter Mediterraneum II in Israel. Bocconea 3: 229–250.
CCDB · ipcn-api-dl — Oberprieler, C. & R. Vogt. 1993. Chromosome numbers of north African phanerogams. II. Willdenowia 23: 211–238.
CCDB · ipcn-api-dl — Probatova, N. S., E. G. Rudyka & A. P. Sokolovskaya. 1996. Chromosome numbers in synanthropic plants from the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 81(5): 98–101.
CCDB · ipcn-api-dl — Malallah, G. A. & G. Brown. 1999. Determination of chromosome number of Kuwaiti flora I. Cytologia 64: 181–196.
CCDB · ipcn-api-dl — Vogt, R. & A. Aparicio. 1999. Chromosome numbers of plants collected during Iter Mediterraneum IV in Cyprus. Bocconea 11: 117–169.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Peng, C. i. & C. c. Hsu. 1978. Chromosome numbers in Taiwan Compositae. Bot. Bull. Acad. Sin. 19: 53–66.
CCDB · ipcn-api-dl — Sidhu, M. K. 1979. Distributional and cytological studies of the weed flora of cultivable fields of Patiala district (Panjab). Ph.D. Thesis, Patiala. 1-230. 1979.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1980. Cyto-palynological studies on weed flora of cultivable lands of Patiala district (Punjab). J. Palynol. 16: 85–105.
CCDB · ipcn-api-dl — Jansen, R. K. & T. F. Stuessy. 1980. Chromosome counts of compositae from Latin America. Amer. J. Bot. 76: 585–594.
CCDB · ipcn-api-dl — KLIPHUIS, E. & J. H. Wieffering. 1979. In IOPB chromosome number reports LXIV. Taxon 28:398–400.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1979. Cytological observations in weed fiora of orchards of Paticla district, Punjab. Recent Res. Pl. Sci. (New Delhi). 7: 261–271.
+82 more references
2n 3611×CCDB · poland · CCDB · ipcn-api-dl · CCDB · book-indian_vol1 +2
CCDB · poland — Walter R. and Kuta E. 1971. Cytological and embryological studies in Sonchus L. I. Sonchus asper (L.) Hill, and Sonchus oleraceus L. Acta Biol. Cracov. Ser. Bot. 14, 103-109.
CCDB · ipcn-api-dl — Kuzmanova, B. & S. Georgieva. 1980. In Chromosome number reports LXIX. Taxon 29: 715.
CCDB · ipcn-api-dl — Belaeva, V. A. & V. N. SIPLIVINSKY. 1976. Chromosome numbers and taxonomy of some species of Baikal flora. Bot. Žhurn. (Moscow & Leningrad) 61(6): 873–880.
CCDB · ipcn-api-dl — Van Loon, J. C. 1980. In Chromosome number reports LXIX. Taxon 29: 718–720.
CCDB · book-indian_vol1 — Kuzmanov, B. & Georgieva, S. 1980
CCDB · book-indian_vol1 — Hsieh, T.-S. et al. 1972; Bir, S.S. & Sidhu, M. 1980
CCDB · CromoCat 2015 — Belaeva, V. A. & Siplivinsky, V. N. (1976). Chromosome numbers and taxonomy of some species of Baikal flora. II. Bot. Žurn. 61(6): 873-880.
CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S. & Nikolova, M. (1993a). Karyological study of Bulgarian Asteraceae. Vll. Fitologija 44: 16-31.
CCDB · CromoCat 2015 — Kuzmanov, B. & Georgieva, S. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 715.
CCDB · CromoCat 2015 — Belaeva, V. A. & Siplivinsky, V. N. (1977). Chromosome numbers and taxonomy of some species of Baikal flora. III. Bot. Žurn. 62: 1132-1142.
GIFT · GIFT (floras)
2n 166×CCDB · book-northern-plants · CCDB · book-indian_vol1 · CCDB · book-fedorov
CCDB · book-northern-plants — Marchal 1920. Erlandsson (L. & L. 1942 b).
CCDB · book-indian_vol1 — Marchal, E. 1920; Tischler, G. 1934, 1937 ; Rohweder, H. 1937 ; Erlandsson (Love, A. & Love, D. 1942b)
CCDB · book-fedorov — Marchal 1920
CCDB · book-fedorov — Ti~chler 1934, 19:17
CCDB · book-fedorov — Rohweder 1937
CCDB · book-fedorov — Erlandsson (Love A., Love D. 1942b)
2n 05×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bala, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1784-1786
CCDB · CromoCat 2015 — Sharma, A. K. (1970). Annual report, 1967-1968 Res. Bull. Univ. Calcutta (Cytogenetics Lab.) 2: 1-50
CCDB · CromoCat 2015 — Jansen, R. K. & Stuessy, T. F. (1980). Chromosome counts of compositae from Latin America. Amer. J. Bot. 76: 585–594.
CCDB · CromoCat 2015 — Sun, B. y., M. R. Sul, J. A. Im, C. H. Kim & T. J. Kim. (2002). Evolution of endemic vascular plants of Ulleungdo and Dokdo in Korea—floristic and cytotaxonomic characteristics of vascular flora of Dokdo. Korean J. Pl. Taxon. 32: 143–158.
2n 252×CCDB · brit-fl · CCDB · book-indian_vol1
CCDB · brit-fl — Barber, H.N. Ann. Bot. (London), n.s. 5: 375-377 (1941)
CCDB · book-indian_vol1 — Barber, H.N. 1941
2n 641×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Hiremath, B. S. & Chennaveeraiah, M. S. (1985). Cytological studies in Sonchus oleraceous Linn. Proceedings of the Indian Academy of Sciences. Plant Sciences 95: 373-377
n 939×CCDB · iapt · CCDB · iber-fl · CCDB · book-ipcn65 +5
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · iber-fl — Palynological and cytological observations in Spanish Sonchus (Asteraceae). Mejas, J. A. & M. J. Dez.Grana32: 343-347(1993).
CCDB · book-ipcn65 — Mehra et al. 1965
CCDB · ipcn-api-dl — Razaq, Z. A., S. Khatoon & S. I. Ali. 1988. A contribution to the chromosome numbers of Compositae from Pakistan. Pakistan J. Bot. 20: 177–189.
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — Ghaffari, S. M. 1989. Chromosome studies in Iranian Compositae. Iran. J. Bot. 4: 189–196.
CCDB · ipcn-api-dl — Prabha, C. 1989. Interspecific hybridisation in the genus Sonchus L. (Asteraceae). Genét. Ibér. 41: 135–145.
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1989. Cytopalynology of north and central Indian Compositae. J. Cytol. Genet. 24: 96–105.
CCDB · ipcn-api-dl — Razaq, Z. A., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800–808.
CCDB · ipcn-api-dl — Sidhu, M. K. 1979. Distributional and cytological studies of the weed flora of cultivable fields of Patiala district (Panjab). Ph.D. Thesis, Patiala. 1-230. 1979.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1979. Cytological observations in weed fiora of orchards of Paticla district, Punjab. Recent Res. Pl. Sci. (New Delhi). 7: 261–271.
CCDB · ipcn-api-dl — Gill, L. S. 1978a. In IOPB chromosome number reports LX. Taxon 27: 223–231.
CCDB · ipcn-api-dl — Gill, L. S. 1978c. Chromosome numbers of angiosperms in Tanzania: II. Adansonia 18: 19–24.
CCDB · ipcn-api-dl — Keil, D. J. & D. J. Pinkava. 1976. Chromosome counts and taxonomic notes for Compositae from the United States and Mexico. Amer. J. Bot. 63: 1393–1403.
CCDB · ipcn-api-dl — Talavera, S., J. A. Devesa & E. F. Galiano. 1984. Notas cariosistemáticas sobre plantas norteafricanas. I. Compositae. Candollea 39: 271–280.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn72 — HSIEH, T-S., A.B. SCHOOLER, A. BELL, J.D. NALEWAJA. 1972. Cytotaxonomy of three Sonchus species. Amer. J. Bot. 59: 789-796.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — GUPTA, P.K. 1969. Cytological investigations in some Indian Composi Cytologia 34: 429-438.
CCDB · book-ipcn67-71 — BAQUAR, S.R., & S.H. ABID ASKARI. 1970. Chromosome numbers in some flowering plants of West Pakistan. Genet. Iber. 22: 1-11.
CCDB · book-ipcn67-71 — SUBRAMANYAM, K., & N. P. KAMBLE. 1967. In IOPB chromosome number reports XII. Taxon 16: 341-350.
CCDB · book-ipcn67-71 — BAQUAR, S.R. & S.H. ABID ASKARI. 1970. Chromosome studies in some flowering plants of West Pakistan. II. Genet. Iber. 22: 41-51.
CCDB · book-ipcn67-71 — WALTER, R., & E. KUTA. 1971. Cytological and embryological studies in Sonchus L. I. Sonchus asper (L.) Hill. and Sonchus oleraceus L. Acta Biol. Cracov., Ser. Bot. 14: 103-109.
CCDB · book-ipcn67-71 — SHARMA, A., & A.K. SARKAR (Editors). 1967-68. Chromosome number reports of plants in Annual Report, Cytogenetics Laboratory, Department of"li"otany, University of Calcutta. The Research Bulletin. 2: 38-Q8.
CCDB · book-ipcn73-74 — SINGH, N.K. 1972. Cytological investigations in some Compositae of I
CCDB · CromoCat 2015 — Baquar, S. R. & Abid Askari, S. H. (1970a). Chromosome numbers in some flowering plants of West Pakistan. Genét. Ibér. 22: 1-11.
CCDB · CromoCat 2015 — Baquar, S. R. & Abid Askari, S. H. (1970b). Chromosome studies in some flowering plants of West Pakistan. II. Genét. Ibér. 22: 41-51.
CCDB · CromoCat 2015 — Gupta, P. K. (1969b). Cytological investigations in some Indian Compositae. Cytologia 34: 429-438.
CCDB · CromoCat 2015 — Mejías, J. A. & M. J. Díez. (1993). Palynological and cytological observations in Spanish Sonchus (Asteraceae). Grana 32: 343-347.
CCDB · CromoCat 2015 — Razaq, Z. A., S. Khatoon & S. I. Ali. (1988). A contribution to the chromosome numbers of Compositae from Pakistan. Pak. J. Bot. 20: 177-189.
CCDB · CromoCat 2015 — Taylor, R. L. & G. A. Mulligan. (1968). Flora of the Queen Charlotte Island. Part 2. Cytologiacl aspects of the Vascular Plants. Queen's Printer Ottawa
CCDB · CromoCat 2015 — Walter, R. & E. Kuta. (1971). Cytological and embryological studies in Sonchus L. I. Sonchus asper (L.) Hill and Sonchus oleraceus L. Acta Biol. Cracov., Ser. Bot. 14: 103-109.
CCDB · CromoCat 2015 — Talavera, S., J. A. Devesa & E. F. Galiano. (1984). Notas cariosistemáticas sobre plantas norteafricanas. I. Compositae. Candollea 39: 271-280.
CCDB · CromoCat 2015 — Subramanyam, K. & N. P. Kamble. (1967). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XII]. Taxon 16(4): 341-350.
CCDB · CromoCat 2015 — Bala, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1784-1786
CCDB · CromoCat 2015 — Gill, L. S. (1978a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LX]. Taxon 27(2/3): 223-231.
CCDB · CromoCat 2015 — Sharma, A. K. (1970). Annual report, 1967-1968 Res. Bull. Univ. Calcutta (Cytogenetics Lab.) 2: 1-50
n 1635×CCDB · iapt · CCDB · iber-fl · CCDB · book-ipcn65 +6
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 404-408. Gallego Cidoncha, M. J.Lagascalia13(2): 311-313(1985).
CCDB · iber-fl — Palynological and cytological observations in Spanish Sonchus (Asteraceae). Mejas, J. A. & M. J. Dez.Grana32: 343-347(1993).
CCDB · book-ipcn65 — Mehra et al. 1965
CCDB · ipcn-api-dl — Razaq, Z. A., S. Khatoon & S. I. Ali. 1988. A contribution to the chromosome numbers of Compositae from Pakistan. Pakistan J. Bot. 20: 177–189.
CCDB · ipcn-api-dl — Gallego Cidoncha, M. J. 1985. Números 404-408, in Números cromosómicos para la flora española. 363-434. Lagascalia 13: 311–313.
CCDB · ipcn-api-dl — Husaini, S. W. H. & G. A. Iwo. 1990. Cytology of some weedy species of the family Compositae (Asteraceae) from Jos Plateau, Nigeria. Feddes Repert. 101: 49–62.
CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1989. Cytopalynology of north and central Indian Compositae. J. Cytol. Genet. 24: 96–105.
CCDB · ipcn-api-dl — Gill, L. S. & D. I. Omoigui. 1992. Chromosome numbers in some Nigerian Compositae. Compositae Newslett. 20/21: 12–15.
CCDB · ipcn-api-dl — Razaq, Z. A., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800–808.
CCDB · ipcn-api-dl — Malallah, G. A. & G. Brown. 1999. Determination of chromosome number of Kuwaiti flora I. Cytologia 64: 181–196.
CCDB · ipcn-api-dl — Peng, C. i. & C. c. Hsu. 1978. Chromosome numbers in Taiwan Compositae. Bot. Bull. Acad. Sin. 19: 53–66.
CCDB · ipcn-api-dl — KLIPHUIS, E. & J. H. Wieffering. 1979. In IOPB chromosome number reports LXIV. Taxon 28:398–400.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1979. Cytological observations in weed fiora of orchards of Paticla district, Punjab. Recent Res. Pl. Sci. (New Delhi). 7: 261–271.
CCDB · ipcn-api-dl — Tomb, A. S., K. L. Chambers, D. W. KYHOS, A. M. Powell & P. H. RAVEN. 1978. Chromosome numbers in the Compositae XIV. Lactuceae. Amer. J. Bot. 65: 717–721.
CCDB · ipcn-api-dl — Koul, A. K., A. K. Wakhlu & J. L. KARIHALOO. 1976a. Chromosome numbers of some flowering plants of Jammu (western Himalayas). II. CIS Chromosome Inform. Serv. 20: 32–33.
CCDB · book-ipcn72 — ALAM, s. 1972. Morphology, cytology, crossability and herbicide reaction of Sonchus arvensis L., ~- oleraceus L., and their hybrids. Bangladesh J. Bot. 1: 179-184.
CCDB · book-ipcn67-71 — POWELL, A.M., & R.M. KING. 1969. Chromosome numbers in the Compositae: West Indian species. Sida 3: 319-320.
CCDB · book-ipcn67-71 — HSU, c.-c. 1970. Preliminary chromosome studies on the vascular plants of Taiwan (III) The aster family, Compositae. Taiwania 15: 17-29.
CCDB · book-ipcn67-71 — WALTER, R., & E. KUTA. 1971. Cytological and embryological studies in Sonchus L. I. Sonchus asper (L.) Hill. and Sonchus oleraceus L. Acta Biol. Cracov., Ser. Bot. 14: 103-109.
CCDB · book-ipcn73-74 — TURNER, B.L;, A.M. POWELL, & T.J. WATSON, JR. 1973. Chromosome numbers in Asteraceae. Amer. J. Bot. 60: 592-596.
CCDB · book-ipcn73-74 — CHAACK, C.G., J.T. WITHERSPOON, & T.J. WATSON. 1974. In IOPB chromosome number reports XLV. Taxon 23: 619-624.
CCDB · Cave1956 — Jinno a
CCDB · CromoCat 2015 — Carr, G. D., King, R. M., Powell, A. M. & Robinson, H. (1999). Chromosome numbers in Compositae. XVIII Amer. J. Bot. 86: 1003-1013.
CCDB · CromoCat 2015 — Gallego, M. J. (1985). Números cromosómicos para la flora española, 404-408. Lagascalia 13(2): 311-313.
CCDB · CromoCat 2015 — Hsu, C. -C. (1970). Preliminary chromosome studies on the vascular plants of Taiwan (III). The aster family, Compositae. Taiwania 15: 17-29.
CCDB · CromoCat 2015 — Mehra, P. N., B. S. Gill, J. K. Mehta & S. S. Sidhu. (1965a). Cytological investigations on the Indian Compositae. I. North Indian taxa. Caryologia 18: 35-68.
CCDB · CromoCat 2015 — Mejías, J. A. & M. J. Díez. (1993). Palynological and cytological observations in Spanish Sonchus (Asteraceae). Grana 32: 343-347.
CCDB · CromoCat 2015 — Powell, A. M. & R. M. King. (1969a). Chromosome numbers in the Compositae: West Indian species. Sida 3: 319-320.
CCDB · CromoCat 2015 — Razaq, Z. A., S. Khatoon & S. I. Ali. (1988). A contribution to the chromosome numbers of Compositae from Pakistan. Pak. J. Bot. 20: 177-189.
CCDB · CromoCat 2015 — Roux, J. & L. Boulos. (1972). Révision systématique du genre Sonchus L. s. l. II. Étude caryologique. Bot. Not. 125: 306-309.
CCDB · CromoCat 2015 — Schaack, C. G., J. T. Witherspoon & T. J. Watson. (1974). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLV]. Taxon 23(4): 622-623.
CCDB · CromoCat 2015 — Walter, R. & E. Kuta. (1971). Cytological and embryological studies in Sonchus L. I. Sonchus asper (L.) Hill and Sonchus oleraceus L. Acta Biol. Cracov., Ser. Bot. 14: 103-109.
CCDB · CromoCat 2015 — Bala, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1784-1786
n 188×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Gupta, R. C. & R. K. Garg. 1987. SOCGI plant chromosome number reports -- IV [i.e., V]. J. Cytol. Genet. 22: 162–163.
CCDB · ipcn-api-dl — Gupta, R. C., B. S. Gill & R. K. Garg. 1989. Chromosomal conspectus of western Himalayan Compositae. Aspects Pl. Sci. 11: 427–437.
CCDB · ipcn-api-dl — Van Loon, J. C. 1980. In Chromosome number reports LXIX. Taxon 29: 718–720.
CCDB · ipcn-api-dl — Jansen, R. K. & T. F. Stuessy. 1980. Chromosome counts of compositae from Latin America. Amer. J. Bot. 76: 585–594.
CCDB · book-ipcn72 — HSIEH, T-S., A.B. SCHOOLER, A. BELL, J.D. NALEWAJA. 1972. Cytotaxonomy of three Sonchus species. Amer. J. Bot. 59: 789-796.
CCDB · CromoCat 2015 — Carr, G. D., King, R. M., Powell, A. M. & Robinson, H. (1999). Chromosome numbers in Compositae. XVIII Amer. J. Bot. 86: 1003-1013.
CCDB · CromoCat 2015 — Gupta, R. C., Gill, B. S. & Garg, R. K. (1989). Chromosomal conspectus of western Himalayan Compositae. Aspects Pl. Sci. 11: 427-437
CCDB · CromoCat 2015 — Jansen, R. K. & Stuessy, T. F. (1980). Chromosome counts of compositae from Latin America. Amer. J. Bot. 76: 585–594.
n 07×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902
CCDB · CromoCat 2015 — Probatova. (2006). Further chromosome studies on vascular plant species from Sakhalin, Moneron and Kurile Islands. Biodivers. Biogeogr. Kuril Islands Sakhalin 2: 93–110.
CCDB · CromoCat 2015 — Nirmala, A. & P. N. Rao. (1989). Karyotype studies in some Asteraceae. Cell Chromosome Res. 12: 17-18
CCDB · CromoCat 2015 — Gemeinholzer (2005). New chromosome counts for some Lactuceae (Compositae). Compositae Newslett. 42: 43–46.
CCDB · CromoCat 2015 — Jansen, R. K. & Stuessy, T. F. (1980). Chromosome counts of compositae from Latin America. Amer. J. Bot. 76: 585–594.
CCDB · CromoCat 2015 — Kamel (2004). Cytotaxonomical investigations of the Egyptian Compositae (Asteraceae): I—Cardueae and Cichorieae. Compositae Newslett. 41: 9–28.
n 102×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Sun, B. y., M. R. Sul, J. A. Im, C. H. Kim & T. J. Kim. 2002. Evolution of endemic vascular plants of Ulleungdo and Dokdo in Korea---floristic and cytotaxonomic characteristics of vascular flora of Dokdo. Korean J. Pl. Taxon. 32: 143–158.
CCDB · CromoCat 2015 — Sun, B. y., M. R. Sul, J. A. Im, C. H. Kim & T. J. Kim. (2002). Evolution of endemic vascular plants of Ulleungdo and Dokdo in Korea—floristic and cytotaxonomic characteristics of vascular flora of Dokdo. Korean J. Pl. Taxon. 32: 143–158.
n 241×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 26
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type507 977 records
Wild obs. + sensor494 043
Museum / vouchered12 496
Cultivated / captive75
Other1 363
Origin
Native37 253
Introduced11 222
Range
Area of Occupancy AOO575 596 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy43% within 1 km
≤100 m 82 489≤1 km 102 654≤10 km 241 141>10 km 3 777
430 061 georeferenced · 63 982 without coordinates
Open the mapobservation + sensor494 043
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy50% within 1 km
≤100 m 875≤1 km 2 716≤10 km 3 343>10 km 320
7 254 georeferenced · 5 242 without coordinates
Open the institutions mapphysical evidence12 496
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 7>10 km 18
25 georeferenced · 50 without coordinates
Open the mapnot free-living75
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions280 of 509 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 2 770 |
| Berlin, DE | 514 |
| Olocation not on record | 247 |
| Adelaide, AU | 212 |
| LDlocation not on record | 207 |
| Moscow State Universitylocation not on record | 182 |
| Wuzhou, CN | 181 |
| Odawara, JP | 162 |
| ASUlocation not on record | 145 |
| Philadelphia, US | 130 |
| Museo Entomologico de Leonlocation not on record | 116 |
| Chongqing Museumlocation not on record | 115 |
| Québec, CA | 112 |
| Claremont, US | 111 |
| Fort Worth, US | 107 |
| Canberra, AU | 106 |
| Bronx, US | 104 |
| Austin, US | 103 |
| Tokushima, JP | 90 |
| Riverside, US | 90 |
| Kensington, AU | 87 |
| Kochi, JP | 85 |
| Turku, FI | 85 |
| Chiba, JP | 84 |
| WTUlocation not on record | 76 |
| Mount Annan, AU | 73 |
| Trondheim, NO | 73 |
| Santa Barbara, US | 72 |
| Bergen, NO | 71 |
| Shinshu Universitylocation not on record | 71 |
| Nagano City, JP | 70 |
| Saint Louis, US | 69 |
| Adam Mickiewicz University in Poznańlocation not on record | 68 |
| Madison, US | 68 |
| Hobart, AU | 66 |
| KMNlocation not on record | 66 |
| San Diego, US | 62 |
| Oskarshamn, SE | 62 |
| SLU Artdatabankenlocation not on record | 62 |
| Auckland, NZ | 60 |
| South Kensington, GB | 56 |
| Oulu, FI | 54 |
| Görlitz, DE | 53 |
| Christchurch, NZ | 51 |
| Brisbane, AU | 51 |
| Tampa, US | 51 |
| Flagstaff, US | 51 |
| BDBClocation not on record | 50 |
| Pullman, US | 49 |
| Phoenix, US | 48 |
| Bloomington, US | 47 |
| Corvallis, US | 47 |
| St. Paul, US | 46 |
| Fukushima Universitylocation not on record | 45 |
| MAlocation not on record | 44 |
| Albuquerque, US | 43 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 42 |
| Allentown, US | 42 |
| Acadia Universitylocation not on record | 42 |
| Denver, US | 41 |
| Uniwersytet Warszawskilocation not on record | 41 |
| BFLlocation not on record | 41 |
| Williamsburg, US | 40 |
| Provincia di Livornolocation not on record | 40 |
| Durango, MX | 39 |
| Kew, GB | 38 |
| San Luis Obispo, US | 38 |
| Ann Arbor, US | 36 |
| Vancouver, CA | 36 |
| University of Stellenboschlocation not on record | 36 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 35 |
| Bando, JP | 34 |
| Burlington, US | 34 |
| Barcelona, ES | 33 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 33 |
| València, ES | 31 |
| CICYTEXlocation not on record | 30 |
| Mexico City, MX | 29 |
| Bangkok, TH | 29 |
| Wlocation not on record | 29 |
| Saint John, CA | 29 |
| Salamanca, ES | 29 |
| US | 28 |
| Canadian Department of Agriculturelocation not on record | 28 |
| TUR-Alocation not on record | 28 |
| Karlsruhe, DE | 28 |
| Arcata, US | 27 |
| Angwin, US | 27 |
| Tsukuba, JP | 27 |
| BClocation not on record | 27 |
| EL PASO, US | 27 |
| Valdosta State Universitylocation not on record | 27 |
| Córdoba, AR | 27 |
| Pamplona, ES | 27 |
| Jena Microbial Resource Collectionlocation not on record | 27 |
| DOI/NPS, Greenbelt Parklocation not on record | 26 |
| US | 26 |
| Entomological Society of Latvialocation not on record | 25 |
| Victoria, CA | 24 |
| Emporia, US | 24 |
| Moscow, US | 24 |
| San Isidro, AR | 24 |
| Bern, CH | 24 |
| College Park, US | 24 |
| TROMlocation not on record | 23 |
| BRNUlocation not on record | 23 |
| Tomioka, JP | 23 |
| UChlocation not on record | 23 |
| Sanda, JP | 22 |
| MeiseBGlocation not on record | 22 |
| University of New Hampshirelocation not on record | 22 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 21 |
| Ciudad Autónoma de Buenos Aires, AR | 21 |
| New Haven, US | 21 |
| UIBlocation not on record | 20 |
| Columbia, US | 20 |
| College of the Atlantic, Museumlocation not on record | 20 |
| Chapel Hill, US | 19 |
| Salzburg, AT | 19 |
| University of Alberta Museumslocation not on record | 19 |
| Hiratsuka City Museumlocation not on record | 19 |
| Uniwersytet Śląski w Katowicachlocation not on record | 19 |
| Jackson, US | 19 |
| Toronto, CA | 19 |
| Kuopio, FI | 18 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 18 |
| BIO-UNIPIlocation not on record | 18 |
| Tuscaloosa, US | 18 |
| Université Lavallocation not on record | 18 |
| Blumenau, BR | 18 |
| Kawasaki Shi Tama Ku, JP | 17 |
| DBF-NHMDlocation not on record | 17 |
| Provo, US | 17 |
| Sagamihara, JP | 16 |
| Tallinn, EE | 16 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 16 |
| Corrientes, AR | 16 |
| Miami, US | 16 |
| KURAlocation not on record | 16 |
| Vitoria, ES | 15 |
| Wellington, NZ | 15 |
| Tartu, EE | 15 |
| Fayetteville, US | 15 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 15 |
| Mexico City, MX | 15 |
| BAYLUlocation not on record | 15 |
| CASlocation not on record | 15 |
| Philadelphia, US | 15 |
| Toyama, JP | 14 |
| Kushiro City Museumlocation not on record | 14 |
| Uppsala, SE | 14 |
| Laboratory of Palaeontologylocation not on record | 14 |
| Jyväskylä, FI | 14 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 14 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 14 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 14 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 14 |
| Texas Lutheran Universitylocation not on record | 13 |
| Pocatello, US | 13 |
| San Angelo, US | 13 |
| Logan, US | 13 |
| Frankfurt am Main | 13 |
| Missoula, US | 13 |
| Rotorua, NZ | 13 |
| GAlocation not on record | 13 |
| Montréal, CA | 13 |
| Helsinki, FI | 12 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 12 |
| Chadron, US | 12 |
| Davis, US | 12 |
| Caldwell, US | 12 |
| Irvine, US | 11 |
| Zapopan, MX | 11 |
| Bozeman, US | 11 |
| Córdoba, ES | 11 |
| Mississippi State, US | 11 |
| National Institute of Biological Resourceslocation not on record | 11 |
| Pittsburg, US | 11 |
| Madrid, ES | 11 |
| Lubbock, US | 11 |
| Otaru, JP | 10 |
| Taipei, TW | 10 |
| GJOlocation not on record | 10 |
| Norfolk, US | 10 |
| Mlocation not on record | 10 |
| Natural History Museum Rotterdamlocation not on record | 10 |
| Tacoma, US | 10 |
| Badajoz, ES | 10 |
| Henderson, US | 10 |
| JP | 10 |
| Beijing, CN | 10 |
| Durban, ZA | 9 |
| Hermosillo, MX | 9 |
| Taipei, TW | 9 |
| LfUlocation not on record | 9 |
| Stockholm, SE | 8 |
| KR | 8 |
| Knoxville, US | 8 |
| Denton, US | 8 |
| NSMKlocation not on record | 8 |
| Sendai, JP | 8 |
| McWane Science Centerlocation not on record | 8 |
| Millersville, US | 8 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 8 |
| GZUlocation not on record | 7 |
| Akita Prefectural Museumlocation not on record | 7 |
| John T. Waterhouse Herbariumlocation not on record | 7 |
| KIRMlocation not on record | 7 |
| Hudson, US | 7 |
| Asheville, US | 7 |
| Cape Town, ZA | 7 |
| TAIElocation not on record | 7 |
| J.F.Oberlin Universitylocation not on record | 7 |
| Alicante, ES | 7 |
| Science Museum of Minnesotalocation not on record | 7 |
| Anchorage, US | 7 |
| Osaka, JP | 7 |
| National Biodiversity Institute, Costa Ricalocation not on record | 6 |
| Glarus, CH | 6 |
| Urumqi, CN | 6 |
| DASSHlocation not on record | 6 |
| Wuhan, CN | 6 |
| Santa Cruz, US | 6 |
| CJBGlocation not on record | 6 |
| Dresden, DE | 6 |
| Garðabær, IS | 6 |
| Davenport, US | 6 |
| Dekalb, US | 6 |
| University of North Carolina at Pembrokelocation not on record | 6 |
| Portland, US | 6 |
| Boise, US | 6 |
| Ishikawa Museum of Natural Historylocation not on record | 6 |
| Obihiro Centennial City Museumlocation not on record | 6 |
| Johnson City, US | 6 |
| Guasave, MX | 6 |
| University of Guelph, OAC Herbariumlocation not on record | 6 |
| Forssa, FI | 5 |
| Nishihara, JP | 5 |
| UNICAMPlocation not on record | 5 |
| Staten Island, US | 5 |
| Iwate Prefectural Museumlocation not on record | 5 |
| Chicago, US | 5 |
| Istituto Agrario Castelnuovolocation not on record | 5 |
| Sevilla, ES | 5 |
| Tall Timbers Research Stationlocation not on record | 5 |
| Tilburg, NL | 5 |
| KOMlocation not on record | 5 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 5 |
| Castelar, AR | 5 |
| Zürich, CH | 5 |
| GMBAlocation not on record | 5 |
| Green Bay, US | 5 |
| ZRC-SAZUlocation not on record | 5 |
| Little Rock, US | 5 |
| Guangzhou, CN | 5 |
| Nishihara, JP | 5 |
| Aarhus, DK | 5 |
| Nagatoro-machi, Chichibu-gun, JP | 5 |
| Xiamen, CN | 5 |
| University of Tennessee at Chattanoogalocation not on record | 5 |
| Los Angeles, US | 5 |
| Altos de Pipe, VE | 5 |
| Zürich, CH | 4 |
| New Brunswick, US | 4 |
| Portland, US | 4 |
| Chicago, US | 4 |
| AUAlocation not on record | 4 |
| Valparaiso, CL | 4 |
| Mount Berry, US | 4 |
| Clemson, US | 4 |
| Lincoln, US | 4 |
| University of Southern Mississippilocation not on record | 4 |
| Stephenville, US | 4 |
| ENTClocation not on record | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| Eastern Nevada Landscape Coalitionlocation not on record | 4 |
| Spearfish, US | 4 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 4 |
| Hangzhou, CN | 4 |
| Fairfax, US | 4 |
| QVMAGlocation not on record | 4 |
| Wuhan, CN | 4 |
| Torreón, MX | 4 |
| Parthenon Tama History Museumlocation not on record | 4 |
| Porrentruy, CH | 4 |
| Universidad de Nariño (UdeNar)location not on record | 3 |
| Chengdu, CN | 3 |
| UFSMlocation not on record | 3 |
| Edinburgh, GB | 3 |
| USFSlocation not on record | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| Dehra Dun, IN | 3 |
| Tlalnepantla, MX | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| UTFPR-CPlocation not on record | 3 |
| Armidale, AU | 3 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 3 |
| Universidad de La Salle (La Salle)location not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| UGentlocation not on record | 3 |
| DNSMlocation not on record | 3 |
| AASlocation not on record | 3 |
| Yangling, CN | 3 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 3 |
| Conway, US | 3 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 3 |
| Minia, EG | 3 |
| San José, CR | 3 |
| La Paz, MX | 3 |
| IDElocation not on record | 3 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 3 |
| Harrisonburg, US | 3 |
| Waverly, US | 3 |
| Montecillo, Texcoco, MX | 3 |
| Chicago, US | 3 |
| UnBlocation not on record | 3 |
| Kathmandu, NP | 3 |
| Campo Mourão, BR | 3 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 3 |
| IWEP FEB RASlocation not on record | 2 |
| Hazara Universitylocation not on record | 2 |
| SEFlocation not on record | 2 |
| HJAEFlocation not on record | 2 |
| UoB-IBlocation not on record | 2 |
| Sapporo, JP | 2 |
| Dover, US | 2 |
| Cambridge, US | 2 |
| Parkville, AU | 2 |
| Awka, NG | 2 |
| PRClocation not on record | 2 |
| INBIOlocation not on record | 2 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 2 |
| Universidade Federal de Pelotaslocation not on record | 2 |
| UDESC-CAVlocation not on record | 2 |
| Zhejiang Universitylocation not on record | 2 |
| NMBU:MINAlocation not on record | 2 |
| Mohonk Preservelocation not on record | 2 |
| UNESClocation not on record | 2 |
| Paris, FR | 2 |
| San Francisco, US | 2 |
| Ensenada, MX | 2 |
| Whitehorse, CA | 2 |
| Pamplona, ES | 2 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 2 |
| Gijón, ES | 2 |
| NSW Office of Environment and Heritagelocation not on record | 2 |
| Cuenca, EC | 2 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 2 |
| Xinxiang, CN | 2 |
| WINlocation not on record | 2 |
| OLAlocation not on record | 2 |
| Ashland, US | 2 |
| Instituto de Investigação Científica Tropicallocation not on record | 2 |
| Mexico City, MX | 2 |
| Muzaffarabad, PK | 2 |
| Cochabamba, BO | 2 |
| Göteborg, SE | 2 |
| La Paz, BO | 2 |
| GNWPlocation not on record | 2 |
| Bourges, FR | 2 |
| Beijing Normal Universitylocation not on record | 2 |
| Philadelphia, US | 2 |
| Urumqi, CN | 2 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 2 |
| Kagoshima, JP | 2 |
| Orem, US | 2 |
| Winterthur, CH | 2 |
| Fulda, DE | 2 |
| Taipei, TW | 2 |
| Korea National Arboretumlocation not on record | 2 |
| Batemans Bay, AU | 2 |
| Palmerston, AU | 2 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 2 |
| Whitewater, US | 2 |
| Weber State Universitylocation not on record | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record | 2 |
| Omachi Alpine Museumlocation not on record | 2 |
| SZUlocation not on record | 2 |
| Keene State Universitylocation not on record | 2 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 2 |
| UFSClocation not on record | 2 |
| PUC-RSlocation not on record | 2 |
| Universidade Federale do Rio Grande do Sullocation not on record | 2 |
| Salvador, BR | 2 |
| Juriquilla, MX | 2 |
| nbflocation not on record | 2 |
| Yaoundé, CM | 2 |
| Turlock, US | 2 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| Morelia, MX | 1 |
| Palmerston North, NZ | 1 |
| Guatemala City, GT | 1 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 1 |
| Porto Alegre, BR | 1 |
| Culiacán, MX | 1 |
| Durham, US | 1 |
| Universidad Nacional de La Pampalocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Northridge, US | 1 |
| UFPRlocation not on record | 1 |
| UFRRJlocation not on record | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| H-Dunkellocation not on record | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| US | 1 |
| University of Lethbridgelocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| Arizona Western Collegelocation not on record | 1 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| SJNAlocation not on record | 1 |
| Kiritappu Wetland National Trustlocation not on record | 1 |
| USFS/BHSClocation not on record | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| Universidad Nacional de Misiones- CONICETlocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 1 |
| KNAMlocation not on record | 1 |
| BSBIlocation not on record | 1 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 1 |
| Durango, US | 1 |
| Ciudad de México, MX | 1 |
| VALElocation not on record | 1 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 1 |
| Buenos Aires, AR | 1 |
| Rovaniemi, FI | 1 |
| CUVClocation not on record | 1 |
| MEXUlocation not on record | 1 |
| Hamilton, US | 1 |
| Paleontological Collectionlocation not on record | 1 |
| UFBAlocation not on record | 1 |
| Universidad Nacional de Asunciónlocation not on record | 1 |
| Oiso Municipal Museumlocation not on record | 1 |
| FUNEDlocation not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Zhuzhou, CN | 1 |
| Quito, EC | 1 |
| Kunming, CN | 1 |
| University of Genevalocation not on record | 1 |
| FLADlocation not on record | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| UNAN-LEONlocation not on record | 1 |
| Dhaka, BD | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| Cenit Transporte y Logística de Hidrocarburos S.A.S. (CENIT)location not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Guilin, CN | 1 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| Zhengzhou, CN | 1 |
| National Museum Waleslocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Banyoles, ES | 1 |
| Xian, CN | 1 |
| Cambridge, US | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| San Sebastián, ES | 1 |
| US | 1 |
| Bratislava, SK | 1 |
| Columbus State Universitylocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| DMZ botanic gardenlocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Richmond, US | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| Post Graduate College Bannulocation not on record | 1 |
| Gifu prefectural Museumlocation not on record | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Nanjing, CN | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| Nijmegen, NL | 1 |
| Rishon Le Zion, IL | 1 |
| H-HarzKurtlocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Guiyang, CN | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| Nanjing, CN | 1 |
| Ivano-Frankivsk, UA | 1 |
| Museo de La Platalocation not on record | 1 |
| Brasília, BR | 1 |
| Coimbra, PT | 1 |
| Podgorica, ME | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Montréal, CA | 1 |
| Hanshan Normal Universitylocation not on record | 1 |
| Edmonton, CA | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 1 |
| Namur, BE | 1 |
| Bend, US | 1 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 1 |
| The Cattle Museumlocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| GB | 1 |
| Blacksburg, US | 1 |
| Gump Stationlocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
509 institutions · 11 739 of 12 496 vouchered records shown · 630 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA69 detections
Where the DNA of Sonchus asper was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found69
Studies independent surveys2
Countries17
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 69 detections have coordinates
Open the map17 countries0
Red soil savanna bushland.Growing in thermal areaManaged boreal mixedwood standon road side
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.9 °C 9.40–24.1
Seasonal swing summer↔winter20.7 °C
Max temp (day)20.5 °C 12.3–31.1
Min temp (night)12.5 °C 6.10–18.7
Precipitation74.0 mm/mo 41.7–112
Air humidity58.7 % 44.1–63.9
Moisture balance-32.7 mm/mo -132–51.9
Vapour deficit794 Pa 406–1,710
Wind speed3.10 m/s 2.00–4.70
Cloud cover41.0 % 34.8–52.4
CHELSA 1981–2010, ~9 km grid, at location & month of 48 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.