Sonchus arvensis

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Sonchus

At a glance

Occurrence records264 787

Data sources15

Biological traits59

DNA specimens71

eDNA detections54

Sources15 archives

Databases and archives Sonchus arvensis's data was compiled from.

WikipediaWikimedia Foundation15 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility264 787 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI54 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics71 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources59 traits

Chemical compositionLOTUS · NPASS68 compounds

Occurrence & distributionGBIF264 787 records

Environmental DNA3 datasets · 14 countries54 detections

DNA & barcodingBOLD · NCBI71 specimens

Genome at a glanceCCDB · GoaT4.7 Gbp

01Narrative

Sonchus arvensis, the field milk thistle,Sonchus arvensis at Plants For A Future field sowthistle, perennial sow-thistle, corn sow thistle, dindle, gutweed, swine thistle, or tree sow thistle, is a species of flowering plant in the family Asteraceae. S. arvensis often occurs in annual crop fields and may cause substantial yield losses.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology21

Fruit length3.5 mm

Fruit length max3 mm

Fruit length min3 mm

Fruit width1 mm

Leaf length max250 mm

Leaf mass606 mg

Leaf size13 128 mm²

⚠ sources differ — LEDA: 13 128 mm² · GIFT: 12 192 mm²

Leaf width70 mm

Leaf width max70 mm

Leaf width min70 mm

Plant height0.863 m

⚠ sources differ — GIFT: 0.863 m · LEDA: 0.875 m · TRY: 1.14 m

Plant height generative1.04 m

Plant height max1.5 m

Plant height min0.06 m

Seed length3.3 mm

Seed mass0.491 mg

⚠ sources differ — TRY: 0.491 mg · LEDA: 0.678 mg · GIFT: 0.672 mg

Seed mass max0.67 mg

Seed mass min0.35 mg

Seed volume0.43 mm³

Seed volume max0.43 mm³

Seed volume min0.43 mm³

Life cycle & reproduction14

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Dehiscenceindehiscent

Dispersal typewater

⚠ sources differ — LEDA: nautochor · GIFT: anemochorous

Flowering endOct

Flowering startJun

Life formperennial

Life spanperennial

Lifespan years3 years

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

⚠ sources differ — LEDA: Geophyte · GIFT: hemicryptophyte

Reproduction asexualabsent

Seed number6 200

Self fertilizationpresent

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 300 m

Elevation mean1 300 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Habitat GIFTLowland

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry8

Leaf C:N ratio23.65 g/g

Leaf c385 mg/g

Leaf dry-matter content (LDMC)100 mg/g

⚠ sources differ — TRY: 100 mg/g · LEDA: 135 mg/g

Leaf n16.29 mg/g

Leaf p3.88 mg/g

Photosynthetic pathwayC3

Seed longevity index0.5

Specific leaf area (SLA)22.24 mm²/mg

Other traits1

Diaspore typeone-seeded generative dispersule

03Chemical composition68 compounds

Compounds documented for Sonchus arvensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Eudesmane sesquiterpenoids12

Flavones12

Ursane and Taraxastane triterpenoids5

Cytochalasan alkaloids4

Farnesane sesquiterpenoids3

Documented compounds68 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,3Z,6S,7R,8S,9R,10R,16R,18E,20R,21S,23S,24R,25S)-25-benzyl-7,8,21-trihydroxy-10-methoxy-16,23-dimethyl-22-methylidene-2,12,27-trioxo-26-azapentacyclo[18.7.0.01,24.05,11.06,9]heptacosa-3,5(11),18-triene-6-carboxamide	present	LOTUS
(1S,4E,6R,12E,14S,15S,17R,18S,19S,20S)-20-benzyl-6-hydroxy-17,18-dimethyl-2,16-dioxa-21-azatetracyclo[12.8.0.01,19.015,17]docosa-4,12-diene-3,22-dione	present	LOTUS
(1S,4Z,7S,8R,9R,10R,11S,17R,19E,21S,22S,24S,25S,26S)-26-benzyl-8,9,22-trihydroxy-11-methoxy-17,24-dimethyl-23-methylidene-3,13,28-trioxo-2-oxa-27-azapentacyclo[19.7.0.01,25.06,12.07,10]octacosa-4,6(12),19-triene-7-carboxamide	present	LOTUS
(2S)-1,2-Di-O-((9Z,12Z,15Z)-Octadeca-9,12,15-Trienoyl)-3-O-Beta-D-Galactopyranosyl Glycerol	present	LOTUS
(3aS,5aR,6R,9aS,9bS)-6-hydroxy-9-(hydroxymethyl)-5a-methyl-3-methylidene-4,5,6,7,9a,9b-hexahydro-3aH-benzo[g][1]benzofuran-2-one	present	LOTUS
(3R)-3-methoxy-3-(3,4,5-trimethoxyphenyl)propan-1-ol	present	LOTUS
(3R,4R,6S)-6-[[(2R,3S,4S,5R,6S)-6-[2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxochromen-7-yl]oxy-3,4,5-trihydroxyoxan-2-yl]methoxy]-3,4,5-trihydroxyoxane-2-carboxylic acid	present	LOTUS
(3S,3aS,5aR,6R,9aS,9bS)-3,5a,9-trimethyl-6-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,3a,4,5,6,7,9a,9b-octahydrobenzo[g][1]benzofuran-2-one	present	LOTUS
(3S,3aS,5aR,6R,9aS,9bS)-3,5a-dimethyl-9-methylidene-6-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,6,7,8,9a,9b-octahydro-3H-benzo[g][1]benzofuran-2-one	present	LOTUS
(3S,3aS,5aR,6R,9aS,9bS)-6-hydroxy-9-(hydroxymethyl)-3,5a-dimethyl-3,3a,4,5,6,7,9a,9b-octahydrobenzo[g][1]benzofuran-2-one	present	LOTUS

05DNA & barcoding71 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sonchus arvensis has left across the world's sequence archives.

At a glance

DNA specimens71

Marker genes9

GenBank sequences10

eDNA detections54

Countries14

The DNA barcodea real sequence read deposited for this species

ITSPZ106872.1 ↗357 bpIndonesia · 2025

ACGT

AATTGACTCGAGTTTTGACGCAAGTTGCGCCCGAAGCCATCCGGTCGAGGGCACGCCTGCCTGGGCGTCACGCATCACGTTGCCCCCCGC …

Sonchus arvensis subsp. arvensis voucher SA0110062025 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★rbcLa★trnL-F★ITS3★ITS1★ITS2atpF-atpHrpoC1

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT

The complete instruction manual Sonchus arvensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 655 280 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Sonchus arvensis4.66 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 54 n = 27

Ploidy6× hexaploid · measured

Chromosome records18–642n range36median54mode98records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 3635×CCDB · slov-fl · CCDB · iapt · CCDB · fl-europaea +10

CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.

CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.

CCDB · iapt — IAPT/IOPB Chromosome Data 13

CCDB · fl-europaea — V. Sorsa, 1962

CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov. Ser. Bot. 14, 55-102.

CCDB · book-ipcn65 — Love & L. in L. & B. 1959

CCDB · ipcn-api-dl — Morton, J. K. 1981. Chromosome numbers in Compositae from Canada and the U.S.A. Bot. J. Linn. Soc. 82: 357–368.

CCDB · ipcn-api-dl — Probatova, N. S., E. G. Rudyka & A. P. Sokolovskaya. 1996. Chromosome numbers in synanthropic plants from the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 81(5): 98–101.

CCDB · ipcn-api-dl — Vachova, M. 1974a. In Index to chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.

CCDB · ipcn-api-dl — Kuzmanov, B. A., S. B. Georgieva & V. A. Nikolova. 1986. Chromosome numbers of Bulgarian flowering plants. I. Fam. Asteraceae. Fitologija 31: 71–74.

CCDB · ipcn-api-dl — Nazarova, E. A. 1984. Chromosome numbers in the Caucasian representatives of the families Asteraceae, Brassicaceae, Fabaceae, Limoniaceae. Bot. Zhurn. SSSR 69(7): 972–975. (In Russian).

CCDB · ipcn-api-dl — Dmitrieva, S. A. 1987. Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23–33.

CCDB · ipcn-api-dl — Nazarova, E. A. 1989. Karyological and palynological study of representatives of the genus Sonchus from the Caucasus. Bot. Žhurn. (Moscow & Leningrad) 74: 53–59.

CCDB · ipcn-api-dl — Gorzko, T., D. Sokólska & K. Bijok. 1980. Karyologic and embryologic studies of Sonchus arvensis L. from natural habitats in northern Poland. Zesz. Nauk. Wydz. Biol. Nauk Ziemi, Biol. 2: 61–68.

CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1991. Chromosome numbers in some plant species from the south-west of the Komi ASSR. Bot. Žhurn. (Moscow & Leningrad) 76: 769–771.

CCDB · ipcn-api-dl — Rostovtseva, T. S. 1979a. Chromosome numbers of some species of the family Asteraceae Dumort. Bot. Zhurn. SSSR 64 (4): 582–589.

CCDB · ipcn-api-dl — Volkova, S. A. & D. D. Basargin. 2002. Chromosome numbers of species of Chabarovsk territory flora. Bot. Žhurn. (Moscow & Leningrad) 87(4): 165–167.

CCDB · ipcn-api-dl — Jalas, J. & K. Pellinen. 1985. Chromosome counts on Erigeron, Hieracium, Pilosella and Sonchus (Compositae), mainly from Finland. Ann. Bot. Fenn. 22: 45–47.

CCDB · book-ipcn67-71 — SKALINSKA, M., A. JANKUN, H. WCISLO ET AL. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov., Ser. Bot. 14: 55-102.

CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.

CCDB · book-indian_vol1 — Skalinska, M. et al. 1971 ; Alam, S. 1972; Hsieh, T.-S. et at. 1972

CCDB · book-indian_vol1 — Shumovich, W. & Montgomery, F.H. 1955; Boulos, L. 1959, 1961; Packer, J.G. 1964; Bir, S.S. & Sidhu, M. 1974

CCDB · eflora

CCDB · book-fedorov — Shumovich, Montgomery 1955

CCDB · book-fedorov — Boulos 1959, 1961

CCDB · book-fedorov — Packer 1964

CCDB · Cave1957 — Mulligan

CCDB · CromoCat 2015 — Dmitrieva, S. A (2000). Karyology of the flora of Byelarus. 42 Thesis of the Diss. Doc. Biol. Sci. Minsk.

CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902

CCDB · CromoCat 2015 — Rostovtseva, T. S. (1979). Chromosome numbers of some species of the family Asteraceae Dumort. Bot. Žurn. 64: 582-589.

CCDB · CromoCat 2015 — Volkova, S. A. & D. D. Basargin. (2002). Chromosome numbers of species of Chabarovsk territory flora. Bot. Žhurn. 87(4): 165–167.

CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S. & Nikolova, M. (1993a). Karyological study of Bulgarian Asteraceae. Vll. Fitologija 44: 16-31.

CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S. & Nikolova, V. (1986). Chromosome numbers of Bulgarian flowering plants. I, Fam. Asteraceae. Fitologija 31: 71-74.

CCDB · CromoCat 2015 — Lavrenko, A. N. & Serditov, N. P. (1991). Chromosome numbers in some plant species from the south-west of the Komi ASSR Bot. Žurn. 76: 769-771.

CCDB · iapt — IAPT/IOPB Chromosome Data 26

2n 5435×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +15

GoaT · DTOL Flowering Plants Estimates Kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.

CCDB · brit-fl — Edmonds, J.M., Sell, P.D., Walters, S.M. Watsonia 10: 159-161 (1974)

CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)

CCDB · brit-fl — Curran, P.L. Irish Naturalists' J. 16: 7-9 (1968)

CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)

CCDB · brit-fl — Jones, K. (1969)

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3908

CCDB · fl-europaea — Gadella & Kliphuis,

CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov. Ser. Bot. 14, 55-102.

CCDB · ipcn-api-dl — Kiehn, M., E. Vitek, E. Hellmayr, J. Walter, J. Tschenett, C. Justin & M. Mann. 1991. Beiträge zur Flora von Österreich: Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 128: 19–39.

CCDB · ipcn-api-dl — Morton, J. K. 1981. Chromosome numbers in Compositae from Canada and the U.S.A. Bot. J. Linn. Soc. 82: 357–368.

CCDB · ipcn-api-dl — Dempsey, R. E., R. J. Gornall & J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.

CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.

CCDB · ipcn-api-dl — Morton, J. K. 1977. A cytological study of the Compositae (excluding Hieracium and Taraxacum) of the British Isles. Watsonia 11: 211–223.

CCDB · ipcn-api-dl — PEGTEL, D. M. 1976. On the ecology of two varieties of Sonchus avensis L. Dissertation, Groningen Universitat. 148 pp.

CCDB · book-ipcn67-71 — CURRAN, P.L. 1968. Chromosome numbers of sone Irish plants. Irish Naturalists' J. 16: 7-9.

CCDB · book-ipcn67-71 — GADELLA, Th. W.J., & E. KLIPHUIS. 1968. Chromosome numbers of flowering plants in the Netherlands IV. Proc. Roy. Netherlands Acad. Sci. ser. C. 71: 168-183.

CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1967. Chromosome numbers of flowering plants in the Netherlands III. Proc. Roy. Neth. Acad. Sci. Ser. c. 70: 7-20.

CCDB · book-ipcn73-74 — GADELLA, T.W.J., & E. KLIPHUIS. 1973. Chromosome numbers of flowerinl plants in the Netherlands VI. Proc. Kon. Ned. Acad. Wet., ser. C 76: 303-311.

CCDB · book-ipcn73-74 — EDMONDS, J.M., P.O. SELL, & S.M. WALTERS. 1974. Some British chromosome counts in the Compositae sub-family Cichorioideae. Watsonia 10: 159-161.

CCDB · book-indian_vol1 — Love, A. & Love, D. 1956b ; Boulos, L. 1961 ; Gadella, T.W.J. & Kliphuis, E. 1963, 1967, 1968a; Curran, P.L. 1968; Edmonds, J.M. eta!. 1974

CCDB · eflora

CCDB · book-fedorov — Love A., LOve D. 1956b

CCDB · book-fedorov — Boulos 1961

CCDB · book-fedorov — Gadella, Kliphuis 1963, 1967

CCDB · iapt — IAPT/IOPB Chromosome Data 17

CCDB · Cave1956 — Love & Love b

CCDB · Cave1957 — Mulligan

CCDB · Cave1963 — Gadella & Klip. 1963

CCDB · CromoCat 2015 — Dempsey, R. E., Gornall, R. J. & Bailey, J. P. (1994). Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63-66.

CCDB · CromoCat 2015 — Dmitrieva, S. A (2000). Karyology of the flora of Byelarus. 42 Thesis of the Diss. Doc. Biol. Sci. Minsk.

CCDB · CromoCat 2015 — Albers, F. & Pröbsting, W. (1998). In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart

CCDB · CromoCat 2015 — Kiehn, M., Vitek, E., Hellmayr, E., Walter, J., Tschenett, J., Justin, C. & Mann, M. (1991). Beiträge zur Flora von Österreich: Chromosomenzählungen. Verhandlungen der Zoologisch-botanischen Gesellschaft in Wien 128: 19-39

2n 1818×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · book-fedorov +3

CCDB · ipcn-api-dl — Prabha, C. & R. P. Roy. 1986. Cytomixis in Sonchus arvensis Linn. Proc. Indian Sci. Congr. Assoc. 73(3–VI): 181.

CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.

CCDB · ipcn-api-dl — Prabha, C. 1988. A report of accessory chromosomes in two diploid species of Sonchus L. Cell Chromosome Res. 11: 28–29.

CCDB · ipcn-api-dl — Hiremath, B. S. 1989. Cytological studies in Sonchus arvensis Linn. Proc. Indian Sci. Congr. Assoc. 76(3,VI): 182.

CCDB · ipcn-api-dl — Singh, S. P. 1993. Karyo-morphological studies of Sonchus arvensis. Proc. Indian Sci. Congr. Assoc. 80(4A): 150–151.

CCDB · ipcn-api-dl — Peng, C. i. & C. c. Hsu. 1978. Chromosome numbers in Taiwan Compositae. Bot. Bull. Acad. Sin. 19: 53–66.

CCDB · ipcn-api-dl — Peng, C. i. & C. c. Hsu. 1977. In IOPB chromosome number reports LVIII. Taxon 26: 557–565.

CCDB · book-indian_vol1 — Shetty, B.V. 1961 ; Sorsa, V. 1963a; Mehra, P.N. et al. 1965 ; Hsu, C.-C. 1970; Remanandan, P. & Mehra, P.N. 1974; Peng, C.-I. & Hsu, C.-C. 1977, 1978

CCDB · book-fedorov — Shetty 1961

CCDB · book-fedorov — Sorsa V. 1963a

CCDB · book-fedorov — Mehra P. N. et al.1965

CCDB · Cave1963 — Sorsa 1962, 1963a

CCDB · CromoCat 2015 — Bellomaria, B. & Hruska, K. (1983). Numeri cromosomici per la flora italiana: 962-966. Inf. Bot. Ital. 15: 53-57.

CCDB · CromoCat 2015 — Hiremath, B. S. (1989). Cytological studies in Sonchus arvensis Linn. Proc. Indian Sci. Congr. Assoc. 76(3,VI): 182.

CCDB · CromoCat 2015 — Prabha, C. (1989). Interspecific hybridisation in the genus Sonchus L. (Asteraceae). Genét. Ibér. 41: 135–145.

CCDB · CromoCat 2015 — Singh, S. P. (1993). Karyo-morphological studies of Sonchus arvensis. Proc. Indian Sci. Congr. Assoc. 80(4A): 150–151.

CCDB · CromoCat 2015 — Peng, C. -I. (1977). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVIII]. Taxon 26(5/6): 562-564.

CCDB · iapt — IAPT/IOPB Chromosome Data 27

2n 646×CCDB · book-northern-plants · CCDB · book-indian_vol1 · CCDB · book-fedorov +1

CCDB · book-northern-plants — Wulff 1937 b. Erlandsson (L. & L. 1942 b).

CCDB · book-indian_vol1 — Erlandsson Love, A. & Love, D. 1942b); Rohweder, H. 1937; Wulff, H.D. 1937b

CCDB · book-fedorov — Erlandsson (LOve A., Love D. 1942b)

CCDB · book-fedorov — Rohweder 1937

CCDB · book-fedorov — Wulff 1937b

CCDB · book-atlas-flowering-plants — Wulff 1937b

2n 05×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Bellomaria, B. & Hruska, K. (1983). Numeri cromosomici per la flora italiana: 962-966. Inf. Bot. Ital. 15: 53-57.

CCDB · CromoCat 2015 — Hiremath, B. S. (1989). Cytological studies in Sonchus arvensis Linn. Proc. Indian Sci. Congr. Assoc. 76(3,VI): 182.

CCDB · CromoCat 2015 — Kumar, R. (1993). Meiotic studies and chromosomal behavior of Sonchus arvensis. Proc. Indian Sci. Congr. Assoc. 80(4A): 152.

CCDB · CromoCat 2015 — Prabha, C. (1989). Interspecific hybridisation in the genus Sonchus L. (Asteraceae). Genét. Ibér. 41: 135–145.

CCDB · CromoCat 2015 — Rostovtseva, T. S. (1979). Chromosome numbers of some species of the family Asteraceae Dumort. Bot. Žurn. 64: 582-589.

2n 322×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S. & Nikolova, M. (1993a). Karyological study of Bulgarian Asteraceae. Vll. Fitologija 44: 16-31.

CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S. & Nikolova, V. (1986). Chromosome numbers of Bulgarian flowering plants. I, Fam. Asteraceae. Fitologija 31: 71-74.

2n 371×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Dmitrieva, S. A (2000). Karyology of the flora of Byelarus. 42 Thesis of the Diss. Doc. Biol. Sci. Minsk.

2n 401×CCDB · poland

CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov. Ser. Bot. 14, 55-102.

2n 601×CCDB · book-fedorov

CCDB · book-fedorov — Tischler 1937

n 914×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2

CCDB · book-ipcn65 — Mehra et al. 1965

CCDB · ipcn-api-dl — Prabha, C. 1989. Interspecific hybridisation in the genus Sonchus L. (Asteraceae). Genét. Ibér. 41: 135–145.

CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.

CCDB · ipcn-api-dl — Hong, D. y. & S. z. Zhang. 1990. Observations on chromosomes of some plants from western Sichuan. Cathaya 2: 191–197.

CCDB · ipcn-api-dl — Hiremath, B. S. 1989. Cytological studies in Sonchus arvensis Linn. Proc. Indian Sci. Congr. Assoc. 76(3,VI): 182.

CCDB · ipcn-api-dl — Kumar, R. 1993. Meiotic studies and chromosomal behavior of Sonchus arvensis. Proc. Indian Sci. Congr. Assoc. 80(4A): 152.

CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.

CCDB · book-ipcn67-71 — HSU, c.-c. 1970. Preliminary chromosome studies on the vascular plants of Taiwan (III) The aster family, Compositae. Taiwania 15: 17-29.

CCDB · Cave1963 — Sorsa 1962, 1963a

CCDB · CromoCat 2015 — Hong, D.-y. & Zhang, S.-z. (1990). Observations on chromosomes of some plants from western Sichuan Observations on chromosomes of some plants from western Sichuan. Cathaya 2: 191-197.

CCDB · CromoCat 2015 — Bellomaria, B. & Hruska, K. (1983). Numeri cromosomici per la flora italiana: 962-966. Inf. Bot. Ital. 15: 53-57.

CCDB · CromoCat 2015 — Hiremath, B. S. (1989). Cytological studies in Sonchus arvensis Linn. Proc. Indian Sci. Congr. Assoc. 76(3,VI): 182.

CCDB · CromoCat 2015 — Kumar, R. (1993). Meiotic studies and chromosomal behavior of Sonchus arvensis. Proc. Indian Sci. Congr. Assoc. 80(4A): 152.

CCDB · CromoCat 2015 — Prabha, C. (1989). Interspecific hybridisation in the genus Sonchus L. (Asteraceae). Genét. Ibér. 41: 135–145.

n 011×CCDB · CromoCat 2015