Sonchus acaulis

Dum.Cours. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Sonchus

At a glance

Occurrence records1 234

Data sources10

Biological traits30

DNA specimens6

eDNA detections3

Sources10 archives

Databases and archives Sonchus acaulis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 234 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources30 traits

Chemical compositionLOTUS7 compounds

Occurrence & distributionGBIF1 234 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Sonchus acaulis is a plant species in the tribe Cichorieae within the family Asteraceae. It is found only on the Canary Islands of Gran Canaria and Tenerife.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology11

Fruit length max3.5 mm

Fruit length min3 mm

Fruit width max1.5 mm

Fruit width min1 mm

Leaf length max600 mm

Leaf length min100 mm

Leaf width max180 mm

Leaf width min60 mm

Plant height0.8 m

Plant height max1.5 m

Plant height min0.5 m

Life cycle & reproduction10

Dehiscenceindehiscent

Flower colouryellow

Flower length max25 mm

Flower length min15 mm

Flower width max50 mm

Flower width min40 mm

Flowering endMay

Flowering startJan

Life spanannual

⚠ sources differ — TRY: annual · GIFT: perennial

Lifespan years4 years

Habitat & environment8

Climatesubtropical

Elevation max1 600 m

Elevation min500 m

Fruit colourbrown

Fruit typeachene

Growth formherb

Leaf formpinnatisect

Woodinessnon-woody

Other traits1

Leaf arrangementrosette

03Chemical composition7 compounds

Compounds documented for Sonchus acaulis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavones5

Simple coumarins2

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
(3S,4S,6S)-3,4,5-trihydroxy-6-[5-hydroxy-2-(4-hydroxyphenyl)-4-oxochromen-7-yl]oxyoxane-2-carboxylic acid	present	LOTUS
Aesculetin	present	LOTUS
Apiumetrin	present	LOTUS
Luteolin 7-glucoside	present	LOTUS
Luteolin 7-glucuronide	present	LOTUS
Luteolin rutinoside	present	LOTUS
Scopoletin	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sonchus acaulis has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSL48290.1 ↗226 bp

ACGT

ATCGCGTCGCCCCCCGCCAAACATCCCCAAAGGTAATCATGGTGATGGGGGCGGAAATTGGCCTCCCGTTCATTGTGTCTGGTTGGCCTA …

Sonchus acaulis Dun.-Cours (Tenerife population) internal transcribed spacer 2 (ITS2) DNA

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★ITS2★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Sonchus acaulis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · kew

CCDB · kew — Suda J, Kyncl T, Freiova R. 2003. Nuclear DNA amounts in Macaronesian angiosperms. Annals of Botany 92: 153-164.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 234 records

Wild obs. + sensor1 205

Museum / vouchered29

Range

Area of Occupancy AOO1 204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 575≤1 km 155≤10 km 194>10 km 26

950 georeferenced · 255 without coordinates

Open the mapobservation + sensor1 205

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 1≤10 km 3

4 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	3
University of Stellenboschlocation not on record	3
Wlocation not on record	3
LDlocation not on record	2
MAlocation not on record	1
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
Salamanca, ES	1
Granada, ES	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
College of the Atlantic, Museumlocation not on record	1
WAGlocation not on record	1
Entomological Society of Latvialocation not on record	1
BClocation not on record	1
MeiseBGlocation not on record	1

14 institutions · 21 of 29 vouchered records shown · 8 without an institution code

09Environmental DNA3 detections

Where the DNA of Sonchus acaulis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–7.40

Seasonal swing summer↔winter26.3 °C

Max temp (day)13.5 °C

Min temp (night)2.80 °C

Precipitation91.3 mm/mo

Air humidity55.7 %

Moisture balance14.2 mm/mo

Vapour deficit458 Pa

Wind speed3.90 m/s

Cloud cover43.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sonchus acaulis

At a glance

Sources10 archives

Size & morphology11

Life cycle & reproduction10

Habitat & environment8

Other traits1

Compound class profile2 classes

Documented compounds7 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 234 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 234 records