Solidago virgaurea
speciesAt a glance
Occurrence records378 838
Data sources14
Biological traits47
DNA specimens40
eDNA detections20
Sources14 archives
Databases and archives Solidago virgaurea's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility378 838 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics40 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources47 traits
Chemical compositionLOTUS · NPASS97 compounds
Occurrence & distributionGBIF378 838 records
Environmental DNA1 datasets · 5 countries20 detections
DNA & barcodingBOLD · NCBI40 specimens
Genome at a glanceCCDB · GoaT1.3 Gbp
01Narrative
Solidago virgaurea, la Solidage verge d'or ou Baguette d'Aaron ou encore Herbe des Juifs, est une espèce de plantes à fleurs du genre des Solidages et de la famille des Astéracées. Il existe de nombreuses sous-espèces et variétés différentes. Cette plante pousse à profusion à la fin de l'été. Son nom viendrait de ses propriétés thérapeutiques, en effet solidor signifie consolider en latin. Il ne faut pas confondre cette plante avec d'autres espèces du genre Solidago qui portent des noms vernaculaires identiques.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass94.49 mg
Leaf size970 mm²
⚠ sources differ — TRY: 970 mm² · LEDA: 2 302 mm² · GIFT: 2 302 mm²
Plant height0.5 m
⚠ sources differ — GIFT: 0.5 m · LEDA: 0.5 m · TRY: 0.09 m
Plant height generative0.526 m
Plant height max1 m
Plant height min0.03 m
Seed length8.18 mm
Seed mass0.547 mg
⚠ sources differ — TRY: 0.547 mg · LEDA: 0.61 mg · GIFT: 0.545 mg
Seed mass max0.69 mg
Seed mass min0.36 mg
Life cycle & reproduction14
DeciduousnessN
⚠ sources differ — TRY: N · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flowering endOct
Flowering startAug
Life formperennial
Life spanperennial
Lifespan years4 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number1 223
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 400 m
Elevation min1 300 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTalpine zone
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf c459 mg/g
Leaf dry-matter content (LDMC)205 mg/g
⚠ sources differ — TRY: 205 mg/g · LEDA: 227 mg/g
Leaf n26.51 mg/g
Leaf p3.61 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)31.32 mm²/mg
⚠ sources differ — TRY: 31.32 mm²/mg · LEDA: 21.19 mm²/mg · GIFT: 21.69 mm²/mg
Wood density299 mg/cm³
Other traits1
Diaspore typeone-seeded generative dispersule
03Chemical composition97 compounds
Compounds documented for Solidago virgaurea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Oleanane triterpenoids27
Colensane and Clerodane diterpenoids23
Flavonols12
Cinnamic acids and derivatives9
Simple phenolic acids8
Documented compounds97 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2-Methoxyphenyl)methyl 2,3,6-trimethoxybenzoate | present | LOTUS | |
| (2-Methoxyphenyl)methyl 2,6-dimethoxybenzoate | present | LOTUS | |
| (2S,5S)-2-[2-(3,4-dihydroxyphenyl)-5,7-dihydroxychromenylium-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol | present | NPASS | |
| (2Z,8Z)-Matricaria Acid Methyl Ester | present | NPASS | |
| (4aR,5R,6aR,6aS,6bR,8aR,9R,10R,11S,12aR,14bS)-10-[(2R,3R,4R,5S,6R)-3,4-dihydroxy-6-(hydroxymethyl)-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-5,11-dihydroxy-9-(hydroxymethyl)-2,2,6a,6b,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (4aR,5R,6aR,6aS,6bR,8aR,9R,10R,11S,12aR,14bS)-5-[(2R,3R,4S,5S,6R)-3-[(2S,3R,4R,5S)-3,4-dihydroxy-5-[(3S)-3-hydroxybutanoyl]oxyoxan-2-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-10,11-dihydroxy-9-(hydroxymethyl)-2,2,6a,6b,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (4aR,5R,6aR,6aS,6bR,8aR,9R,10R,11S,12aR,14bS)-5-[(2R,3R,4S,5S,6R)-3-[(2S,3S,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-10,11-dihydroxy-9-(hydroxymethyl)-2,2,6a,6b,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (4aS,7R,8R,8aS)-4,7,8-trimethyl-8-[2-(5-oxo-2H-furan-4-yl)ethyl]-1,2,5,6,7,8a-hexahydronaphthalene-4a-carboxylic acid | present | LOTUS | |
| (4aS,7R,8R,8aS)-7,8-dimethyl-4-[[(Z)-2-methylbut-2-enoyl]oxymethyl]-8-[2-(5-oxo-2H-furan-4-yl)ethyl]-1,2,5,6,7,8a-hexahydronaphthalene-4a-carboxylic acid | present | LOTUS | |
| (4aS,7R,8R,8aS)-8-[2-(furan-3-yl)ethyl]-4,7,8-trimethyl-1,2,5,6,7,8a-hexahydronaphthalene-4a-carboxylic acid | present | LOTUS |
05DNA & barcoding40 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solidago virgaurea has left across the world's sequence archives.
At a glance
DNA specimens40
Marker genes6
GenBank sequences10
eDNA detections20
Countries5
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATC …
Solidago virgaurea voucher EDNA21-0061469 internal transcribed spacer region, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL4★rbcLa★ITS5★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Solidago virgaurea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 271 400 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Solidago virgaurea1.27 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records16–902n range18median18mode85records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1881×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +15
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Uhríková A. & Bernátová D., 2000: Karyologické štúdium slovenskej flóry XXXII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 40: 31-36.
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Bernátová D., 2007: [New records in Betonica, Buphtalmum, Dianthus, Pilosella, Polygonatum, Prenanthes, Ranunculus, Silene, Solidago, Tragopogon, Trifolium, and Tussilago], pp. 125, 135, 225, 440, 461, 468, 488, 497, 547, 554, 588, 592, 596. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · iapt
CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Irish Naturalists' J. : ()
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · iber-fl — IOPB. Chromosome number reports. LIX. Loon, J. & M. de Jong.Taxon27(1): 57-60(1978).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. II. Compositae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 299-314(1973).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4000
CCDB · poland — Skali?ska M., Pogan E., Czapik R. et al. 1978. Further studies in chromosome numbers of Polish Angiosperms. Twelfth contribution. Acta Biol. Cracov. Ser. Bot. 21, 31-63.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1984. Khrom. Chisla Tsvet. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1987. Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23–33.
CCDB · ipcn-api-dl — Kartashova, N. N., L. A. MALAKHOVA, Koslova & N. A. Dubrova. 1974. Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk. 47–53.
CCDB · ipcn-api-dl — Lippert, W. & G. R. Heubl. 1989. Chromosomenzahlen von Pflanzen aus Bayern und angrenzenden Gebieten: [Teil 2]. Ber. Bayer. Bot. Ges. 60: 73–83.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1991. Chromosome numbers in some plant species from the south-west of the Komi ASSR. Bot. Žhurn. (Moscow & Leningrad) 76: 769–771.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1991. Chromosome numbers in some species of vascular plants from the Pechoro-Ilychsky Reservation (Komi ASSR). Bot. Žhurn. (Moscow & Leningrad) 76: 473–476.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Skalinska, M. 1978. Further studies in chromosome numbers of Polish angiosperms. Twelfth contribution. Acta Biol. Cracov., Ser. Bot. 21: 31–63.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Garbari, F. 1979. Cytotaxonomical and biosystematic aspects of the Mediterranean flora. Webbia 34: 337–355.
CCDB · ipcn-api-dl — Kuzmanov, B., S. Georgieva, V. Nikolova & I. Penceva. 1981a. In Chromosome number reports LXXII. Taxon 30: 701–702.
CCDB · ipcn-api-dl — Malakhova, L. A., O. L. Voronova & A. A. KOZLOVA. 1979. Chromosome numbers of some species of the flora of Sibirian lime-forests. Chernevaja Tajga i Problema Reliktov. Tomsk. 47–51.
CCDB · ipcn-api-dl — Belaeva, V. A. & V. N. SIPLIVINSKY. 1975. Chromosome numbers and taxonomy of some species of Baikal flora. Bot. Žhurn. (Moscow & Leningrad) 60(6): 864–872.
CCDB · ipcn-api-dl — Morton, J. K. 1977. A cytological study of the Compositae (excluding Hieracium and Taraxacum) of the British Isles. Watsonia 11: 211–223.
CCDB · ipcn-api-dl — Skalinska, M., E. Pogan, R. CZAPIK & e. al. 1978. Further studies in chromosome numbers of Polish angiosperms. XII. Acta Biol. Cracov., Ser. Bot. 21: 31–63.
CCDB · ipcn-api-dl — Dmitrieva, S. A., V. I. Parfenov & I. V. SCHVEC. 1977. The karyological characterization of some species of the Belorussian flora. Vesci Akad. Navuk Belarusk SSR Ser. Bi jal. Sel'skagasp. Navuk. 19: 82–91.
CCDB · ipcn-api-dl — KARTASHOVA, N. N., L. A. MALAKHOVA & A. A. KOZLOVA. 1974. Study of the chromosomes of the representatives of the Ob region flora. I. Number of chromosomes of the Tomsk district. Naucn. Dokl. Vyss. Shkoly, Biol. Nauki 4: 114–119.
CCDB · ipcn-api-dl — Belaeva, V. A. & V. Siplivinsky. 1981. In Chromosome number reports LXXIII. Taxon 30: 857–860.
CCDB · ipcn-api-dl — Huber, W. & M. Baltisberger. 1992. IOPB chromosome data 4. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 18/19: 6–8.
CCDB · ipcn-api-dl — Teppner, H. 1980. Karyologie und systematik einiger Gefabpilanzen der Ostalpen. Phyton (Horn) 20: 73–94.
CCDB · ipcn-api-dl — Vachova, M. 1976. In Index of chromosome uumbers of Slovakian flora. Part 5. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1–18.
CCDB · ipcn-api-dl — Krasnikov, A. A. 1984. In R.E. Krogulevich & T.S. Rostovtseva, Khromosomnye Chisla Tsvetkovykh Rastenii i Sibiri Dal'nego Vostoka. Izdatel'stvo "Nauka", Sibirskoe Otdelenie, Novosibirsk. ý.
+34 more references
2n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Mathew, A. & Mathew, P. M. (1988). Cytological studies on the south Indian Compositae Glimpses Pl. Res. 8: 1-177.
CCDB · CromoCat 2015 — Bala, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1784-1786
2n 442×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.
CCDB · CromoCat 2015 — Mathew, A. & Mathew, P. M. (1988). Cytological studies on the south Indian Compositae Glimpses Pl. Res. 8: 1-177.
2n 161×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 26
2n 901×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database — ↗
n 915×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +4
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1983. Chromosome numbers of some species of the family Asteraceae II. Bot. Zhurn. SSSR 68(5): 660–664. (In Russian).
CCDB · ipcn-api-dl — Gupta, R. C. & R. K. Garg. 1987. SOCGI plant chromosome number reports -- IV [i.e., V]. J. Cytol. Genet. 22: 162–163.
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1989. Cytopalynology of north and central Indian Compositae. J. Cytol. Genet. 24: 96–105.
CCDB · ipcn-api-dl — Gupta, R. C., B. S. Gill & R. K. Garg. 1989. Chromosomal conspectus of western Himalayan Compositae. Aspects Pl. Sci. 11: 427–437.
CCDB · ipcn-api-dl — Kuzmanov, B., S. Georgieva, V. Nikolova & I. Penceva. 1981a. In Chromosome number reports LXXII. Taxon 30: 701–702.
CCDB · ipcn-api-dl — Teppner, H. 1980. Karyologie und systematik einiger Gefabpilanzen der Ostalpen. Phyton (Horn) 20: 73–94.
CCDB · book-ipcn67-71 — HSU, c.-c. 1970. Preliminary chromosome studies on the vascular plants of Taiwan (III) The aster family, Compositae. Taiwania 15: 17-29.
CCDB · book-ipcn67-71 — SHETTY, B. V. 1967. In IOPB chromosome number reports XIV. Taxon 16: 552-571.
CCDB · book-ipcn73-74 — MEHRA, P.N., & R. REMANANDAN. 1974. Cytolog>cal >nvestigat>ons on th[ Indian Compositae. II. Astereae, Hel~antheae, Helenleae, and Anthemideae. Caryologia 27: 255-289.
CCDB · Cave1962 — Arano 1962b
CCDB · Cave1963 — Sorsa 1962
CCDB · CromoCat 2015 — Shetty, B. V. (1967). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XIV]. Taxon 16(6): 562-571.
CCDB · CromoCat 2015 — Bala, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1784-1786
CCDB · CromoCat 2015 — Teppner, H. (1980). Karyologie und systematik einiger gefäpflanzen der Ostalpen. Phyton (Horn) 20: 73-94.
n 202×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · CromoCat 2015 — Rostovtseva, T. S. (1979). Chromosome numbers of some species of the family Asteraceae Dumort. Bot. Žurn. 64: 582-589.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Lövkvist, B. & Hultgård, U.-M. (1999). Chromosome numbers in south Swedish vascular plants Opera botanica 137: 1-42
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type378 838 records
Wild obs. + sensor361 409
Museum / vouchered15 158
Cultivated / captive30
Fossil1
Other2 240
Origin
Native17 401
Introduced27
Range
Area of Occupancy AOO540 240 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy53% within 1 km
≤100 m 92 618≤1 km 71 390≤10 km 143 165>10 km 3 365
310 538 georeferenced · 50 871 without coordinates
Open the mapobservation + sensor361 409
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy32% within 1 km
≤100 m 906≤1 km 2 756≤10 km 7 295>10 km 494
11 451 georeferenced · 3 707 without coordinates
Open the institutions mapphysical evidence15 158
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 5>10 km 13
18 georeferenced · 12 without coordinates
Open the mapnot free-living30
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions110 of 217 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 7 825 |
| Moscow State Universitylocation not on record | 577 |
| LDlocation not on record | 462 |
| Salzburg, AT | 401 |
| BFLlocation not on record | 271 |
| Oulu, FI | 238 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 195 |
| Oskarshamn, SE | 165 |
| Bergen, NO | 162 |
| Olocation not on record | 156 |
| Trondheim, NO | 153 |
| TROMlocation not on record | 151 |
| Turku, FI | 150 |
| Bando, JP | 130 |
| Jyväskylä, FI | 128 |
| South Kensington, GB | 108 |
| SLU Artdatabankenlocation not on record | 95 |
| Guangzhou, CN | 94 |
| GMBAlocation not on record | 89 |
| València, ES | 83 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 82 |
| MAlocation not on record | 80 |
| Uniwersytet Warszawskilocation not on record | 79 |
| Kuopio, FI | 79 |
| Entomological Society of Latvialocation not on record | 76 |
| Taipei, TW | 65 |
| KMNlocation not on record | 64 |
| Vitoria, ES | 57 |
| Barcelona, ES | 56 |
| Tallinn, EE | 52 |
| QAUlocation not on record | 51 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 50 |
| Wlocation not on record | 49 |
| TUR-Alocation not on record | 49 |
| Tartu, EE | 48 |
| BDBClocation not on record | 45 |
| Beijing, CN | 42 |
| Provincia di Livornolocation not on record | 42 |
| BRNUlocation not on record | 39 |
| Yangling, CN | 38 |
| San Sebastián, ES | 35 |
| Odawara, JP | 35 |
| CICYTEXlocation not on record | 34 |
| Salamanca, ES | 32 |
| Berlin, DE | 31 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 30 |
| JP | 30 |
| Urumqi, CN | 28 |
| BClocation not on record | 25 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 24 |
| FJIDClocation not on record | 23 |
| Uppsala, SE | 23 |
| Chengdu, CN | 21 |
| Karlsruhe, DE | 20 |
| Zürich, CH | 20 |
| Helsinki, FI | 20 |
| Rovaniemi, FI | 19 |
| College of the Atlantic, Museumlocation not on record | 19 |
| Mlocation not on record | 18 |
| Adam Mickiewicz University in Poznańlocation not on record | 17 |
| Zürich, CH | 17 |
| Kushiro City Museumlocation not on record | 17 |
| Natural History Museum Rotterdamlocation not on record | 16 |
| Otaru, JP | 16 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 15 |
| Chengdu, CN | 14 |
| Madrid, ES | 14 |
| Wuhan, CN | 13 |
| Urumqi, CN | 13 |
| DBF-NHMDlocation not on record | 13 |
| GJOlocation not on record | 12 |
| PRClocation not on record | 12 |
| Porrentruy, CH | 12 |
| Görlitz, DE | 12 |
| BSBIlocation not on record | 11 |
| Uniwersytet Śląski w Katowicachlocation not on record | 10 |
| Stockholm, SE | 10 |
| Philadelphia, US | 10 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 10 |
| Tomioka, JP | 9 |
| Nanjing, CN | 9 |
| Granada, ES | 9 |
| Alicante, ES | 9 |
| Sanda, JP | 9 |
| Paris, FR | 9 |
| Fulda, DE | 8 |
| Dresden, DE | 8 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 8 |
| Inner Mongolia Universitylocation not on record | 8 |
| Nagasaki University - Fisherieslocation not on record | 8 |
| Badajoz, ES | 8 |
| Guilin, CN | 8 |
| Bronx, US | 8 |
| Pamplona, ES | 7 |
| 东北师范大学自然博物馆location not on record | 7 |
| Pamplona, ES | 7 |
| University of Alberta Museumslocation not on record | 7 |
| MeiseBGlocation not on record | 7 |
| ISAlocation not on record | 7 |
| Québec, CA | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| NMBU:MINAlocation not on record | 6 |
| Museo Entomologico de Leonlocation not on record | 6 |
| Tula State Universitylocation not on record | 6 |
| IWEP FEB RASlocation not on record | 6 |
| Hangzhou, CN | 6 |
| Bourges, FR | 6 |
| GZUlocation not on record | 6 |
| Frauenfeld, CH | 5 |
| Montréal, CA | 5 |
| Naturalis Biodiversity Centerlocation not on record | 5 |
| Nanjing, CN | 5 |
| Saint Louis, US | 5 |
| Xiamen, CN | 5 |
| CJBGlocation not on record | 5 |
| SWlocation not on record | 5 |
| Philadelphia, US | 5 |
| Göteborg, SE | 4 |
| Christchurch, NZ | 4 |
| Tilburg, NL | 4 |
| Kew, GB | 4 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 4 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 4 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 4 |
| Hobart, AU | 4 |
| UGentlocation not on record | 4 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 4 |
| ENTClocation not on record | 3 |
| Peking Universitylocation not on record | 3 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 3 |
| Guiyang, CN | 3 |
| Monastir, TN | 3 |
| Banyoles, ES | 3 |
| Sevilla, ES | 3 |
| Dehra Dun, IN | 3 |
| WNNUlocation not on record | 3 |
| Forssa, FI | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| University of Stellenboschlocation not on record | 3 |
| nlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Wellington, NZ | 3 |
| Frankfurt am Main | 3 |
| Museo Achille Folettolocation not on record | 3 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 3 |
| Chicago, US | 3 |
| Iwate Prefectural Museumlocation not on record | 3 |
| Chicago, US | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| LfUlocation not on record | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Taipei, TW | 2 |
| Podgorica, ME | 2 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 2 |
| Davenport, US | 2 |
| Ivano-Frankove, UA | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Lausanne, CH | 2 |
| ULBF-AGRlocation not on record | 2 |
| Canberra, AU | 2 |
| Gijón, ES | 2 |
| Awka, NG | 2 |
| Kandalaksha State Nature Reservelocation not on record | 2 |
| Guangxi Medicinal Botanic Gardenlocation not on record | 2 |
| Jaén, ES | 2 |
| Zhejiang Universitylocation not on record | 2 |
| Coimbra, PT | 2 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 2 |
| Edinburgh, GB | 1 |
| Taipei, TW | 1 |
| Namur, BE | 1 |
| BGBMlocation not on record | 1 |
| STUlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| US | 1 |
| SCAUlocation not on record | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| Nijmegen, NL | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Fort Worth, US | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Durham, US | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Kunming, CN | 1 |
| JBAlocation not on record | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| Logan, US | 1 |
| Davis, US | 1 |
| SZUlocation not on record | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| CASlocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| nbflocation not on record | 1 |
| Sion, CH | 1 |
| Tromso University Museumlocation not on record | 1 |
| Minia, EG | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Chongqing Museumlocation not on record | 1 |
| Vancouver, CA | 1 |
| H-Schuhwlocation not on record | 1 |
| Umeå Universitylocation not on record | 1 |
| AUT001location not on record | 1 |
| Hokkaido University Museumlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Zhuzhou, CN | 1 |
| Xian, CN | 1 |
| University of Hulllocation not on record | 1 |
| Pocatello, US | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| EL PASO, US | 1 |
| CJBNlocation not on record | 1 |
| Madison, US | 1 |
| UoB-IBlocation not on record | 1 |
| Sapporo, JP | 1 |
217 institutions · 13 979 of 15 158 vouchered records shown · 988 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA20 detections
Where the DNA of Solidago virgaurea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found20
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 20 detections have coordinates
Open the map5 countries0
in broadleaf woodland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.5 °C 10.8–17.3
Seasonal swing summer↔winter15.4 °C
Max temp (day)17.4 °C 12.9–21.8
Min temp (night)10.5 °C 7.60–12.9
Precipitation90.8 mm/mo 68.8–120
Air humidity62.4 % 59.5–66.7
Moisture balance0.8 mm/mo -41.6–30.8
Vapour deficit614 Pa 461–806
Wind speed3.60 m/s 2.40–5.00
Cloud cover49.4 % 36.6–63.1
CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.