Solidago sphacelata

Raf. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Solidago

At a glance

Occurrence records373

Data sources8

Biological traits7

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Solidago sphacelata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility373 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF373 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Solidago sphacelata, commonly known as false goldenrod or autumn goldenrod, is a North American species of goldenrod in the family Asteraceae. It is native to the eastern United States from Virginia and the Carolinas west as far as Illinois and Mississippi.Biota of North America Program 2014 county distribution map Solidago sphacelata is a drought-tolerant, perennial herb up to 120 cm (4 feet) tall, with an underground caudex and rhizomes. One plant can produce as many as 250 small yellow flower heads in a large branching array at the top of the plant.Flora of North America, Solidago sphacelata Rafinesque, 1820. False or autumn goldenrod The bright yellow color of the flowers primarily attracts butterfly pollinators.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solidago sphacelata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPZ221237.1 ↗630 bpUSA · 2002

ACGT

TCGAAGCCTGCAAAGCAGAACGACCCGTGAACATGTTATAACAACCATGCCAGGATGGGTCGGACGTCAGTTCGATTCTCATGGCACACC …

Solidago sphacelata voucher Marcum et al. PBM 1712, TENN internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Solidago sphacelata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 184×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71 +1

CCDB · ipcn-api-dl — Semple, J. C., J. Zhang & C. Xiang. 1993. Chromosome number determinations in fam. Compositae, tribe Astereae. V. Eastern North American taxa. Rhodora 95: 234–253.

CCDB · book-ipcn66 — Kapoor & Beaudry 1966

CCDB · book-ipcn67-71 — BEAUDRY, J.R. 1969. Etudes sur les Solidago L. IX. Une liste de nombres chromosomiques des taxons du genre Solidago et de certains genres voisins. Naturaliste Canad. 96: 103-114.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type373 records

Wild obs. + sensor150

Museum / vouchered223

Range

Area of Occupancy AOO1 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 81≤1 km 10≤10 km 7>10 km 34

132 georeferenced · 18 without coordinates

Open the mapobservation + sensor150

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 7≤1 km 52≤10 km 90>10 km 23

172 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence223

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bloomington, US	37
Philadelphia, US	31
Chapel Hill, US	26
Knoxville, US	19
Bronx, US	16
Longwood Universitylocation not on record	14
Jackson, US	9
Bangkok, TH	8
Madison, US	8
Chongqing Museumlocation not on record	6
Williamsburg, US	6
Norfolk, US	4
Tuscaloosa, US	4
CJBGlocation not on record	3
Morgantown, US	3
Chicago, US	3
University of Tennessee at Chattanoogalocation not on record	2
University of Wisconsinlocation not on record	2
GB	2
Richmond, US	2
Fairfax, US	1
Asheville, US	1
Johnson City, US	1
Saint Louis, US	1
Moscow, US	1
Pondicherry, IN	1
Boise, US	1
University of Alberta Museumslocation not on record	1
Québec, CA	1
Elikins, US	1
Denver, US	1
Durham, US	1
Columbia, US	1
Western Carolina Universitylocation not on record	1
GAlocation not on record	1

35 institutions · 220 of 223 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)