Solidago shortii

Torr. & A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Solidago

At a glance

Occurrence records20

Data sources12

Biological traits7

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Solidago shortii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility20 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Chemical compositionLOTUS · NPASS5 compounds

Occurrence & distributionGBIF20 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Solidago shortii, commonly known as Short's goldenrod, is a species of goldenrod in the family Asteraceae. The only known populations of Short's goldenrod occur around the Blue Licks Battlefield State Park area of Kentucky and Harrison-Crawford State Forest in Indiana. It was listed on the Federal Register of Endangered Species on September 5, 1985, and was given a global rank of G1 (critically endangered) on February 29, 2000.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition5 compounds

Compounds documented for Solidago shortii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Halimane diterpenoids4

Colensane and Clerodane diterpenoids2

Isoquinoline alkaloids $ Protoberberine alkaloids1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
(14S)-16,17-dimethoxy-5,7-dioxa-13-azapentacyclo[11.8.0.02,10.04,8.015,20]henicosa-1(21),2,4(8),9,15(20),16,18-heptaen-14-ol	present	NPASS
3-[2-[(1R,2R,3aR,6S,8aR)-6,8a-dihydroxy-1,2,5,5-tetramethyl-4-oxo-2,3,3a,6,7,8-hexahydroazulen-1-yl]ethyl]-2H-furan-5-one	present	LOTUS
3-[2-[(2S,3aS,5R,6R,8aS)-2,8a-dihydroxy-1,1,5,6-tetramethyl-4-oxo-2,3,3a,6,7,8-hexahydroazulen-5-yl]ethyl]-2H-furan-5-one	present	LOTUS
[(1aR,3aR,4R,5S,6S,7aR,7bS)-4,5,7a,7b-tetramethyl-4-[2-(5-oxo-2H-furan-3-yl)ethyl]-2,3,3a,5,6,7-hexahydro-1aH-naphtho[1,2-b]oxiren-6-yl] (Z)-2-methylbut-2-enoate	present	LOTUS
[(1aS,3aR,4R,5S,6S,7aR,7bR)-4,5,7a,7b-tetramethyl-4-[2-(5-oxo-2H-furan-3-yl)ethyl]-2,3,3a,5,6,7-hexahydro-1aH-naphtho[1,2-b]oxiren-6-yl] (Z)-2-methylbut-2-enoate	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solidago shortii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAY523854.1 ↗627 bp

ACGT

TCGAAGCCTGCAAAGCAGAACGACCCGTGAACATGTTATAACAACCATGCCAGGATGGGTCGGACGTCAGTTCGATTCTCATGGCACACC …

Solidago shortii internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Solidago shortii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome records18–362n range36median36mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 363×CCDB · book-ipcn67-71 · CCDB · eflora · CCDB · Cave1963

CCDB · book-ipcn67-71 — CHOUKSANOVA, N.A., L.I. SVESHNIKOVA, & T.V. ALEXANDROVA. 1968. Data on karyology of the family Compositae Giseke. Citologija 10: 198-206.

CCDB · eflora

CCDB · Cave1963 — Beaudry 1963

2n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Semple, J. C., J. Zhang & C. Xiang. 1993. Chromosome number determinations in fam. Compositae, tribe Astereae. V. Eastern North American taxa. Rhodora 95: 234–253.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type20 records

Wild obs. + sensor8

Museum / vouchered11

Cultivated / captive1

Range

Area of Occupancy AOO60 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 8

8 georeferenced

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 2

5 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence11

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	5
Bronx, US	1
Jena Microbial Resource Collectionlocation not on record	1
Saint Louis, US	1
South Kensington, GB	1

5 institutions · 9 of 11 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Solidago shortii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)